Incidental Mutation 'R3082:Cpsf2'
ID265500
Institutional Source Beutler Lab
Gene Symbol Cpsf2
Ensembl Gene ENSMUSG00000041781
Gene Namecleavage and polyadenylation specific factor 2
Synonyms100kDa, 2610024B04Rik, Cpsf
MMRRC Submission 040572-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3082 (G1)
Quality Score103
Status Validated
Chromosome12
Chromosomal Location101975988-102006424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 101988810 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 280 (S280C)
Ref Sequence ENSEMBL: ENSMUSP00000047797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047357]
Predicted Effect probably damaging
Transcript: ENSMUST00000047357
AA Change: S280C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781
AA Change: S280C

DomainStartEndE-ValueType
Lactamase_B 17 223 5.22e-1 SMART
Beta-Casp 243 368 1.8e-21 SMART
coiled coil region 380 418 N/A INTRINSIC
Pfam:RMMBL 527 569 1.2e-14 PFAM
Pfam:CPSF100_C 608 779 5.7e-46 PFAM
Meta Mutation Damage Score 0.5736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Adam11 T C 11: 102,770,117 probably benign Het
Aox2 G T 1: 58,283,600 probably benign Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Cep63 T C 9: 102,602,497 T339A probably benign Het
Clcn1 T C 6: 42,290,178 Y66H probably damaging Het
Dcaf6 G T 1: 165,422,852 probably benign Het
Ddx39 T A 8: 83,722,706 N344K possibly damaging Het
Dvl1 T C 4: 155,847,859 V42A possibly damaging Het
Ep400 A G 5: 110,693,230 probably benign Het
Epb41l5 C T 1: 119,609,262 V300I probably damaging Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Ints13 G T 6: 146,574,707 Q99K possibly damaging Het
L2hgdh C T 12: 69,722,084 D85N probably benign Het
Lct A G 1: 128,287,608 Y1744H probably damaging Het
Macf1 T C 4: 123,361,443 probably null Het
Mpdz A T 4: 81,285,458 probably benign Het
Naa15 T C 3: 51,460,050 L498P probably damaging Het
Naip6 T A 13: 100,316,417 E45D probably benign Het
Nedd4l T A 18: 65,178,978 N405K probably benign Het
Olfr1037 C T 2: 86,085,709 V23I probably benign Het
Olfr724 A G 14: 49,960,704 Y123H probably damaging Het
Pitpnc1 A G 11: 107,212,524 S250P possibly damaging Het
Ppp1r18 A G 17: 35,873,850 D131G probably damaging Het
Prdm5 A G 6: 65,936,085 D206G probably damaging Het
Pygl A G 12: 70,197,529 F455S probably damaging Het
Rictor A T 15: 6,774,857 Y565F probably benign Het
Ryr1 T C 7: 29,045,646 N3852D probably damaging Het
S1pr5 A T 9: 21,244,990 C47S probably damaging Het
Serpinf2 T C 11: 75,437,528 R65G probably benign Het
Slfn14 C T 11: 83,276,693 W665* probably null Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Spata18 A G 5: 73,679,080 probably benign Het
Tex19.2 A G 11: 121,116,731 V297A probably benign Het
Tmem131l A G 3: 83,909,150 probably null Het
Trim9 T C 12: 70,255,113 R584G possibly damaging Het
Trpm7 A T 2: 126,844,422 N295K possibly damaging Het
Ugt2a3 A G 5: 87,325,675 V461A probably benign Het
Vmn1r45 A T 6: 89,933,742 M82K probably benign Het
Other mutations in Cpsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cpsf2 APN 12 101983466 missense probably damaging 1.00
IGL01114:Cpsf2 APN 12 101989839 missense possibly damaging 0.93
IGL01121:Cpsf2 APN 12 101988706 missense probably damaging 1.00
IGL01377:Cpsf2 APN 12 101987381 splice site probably null
IGL01465:Cpsf2 APN 12 101997333 missense probably damaging 1.00
IGL02861:Cpsf2 APN 12 101999566 missense probably benign 0.00
R0469:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0504:Cpsf2 UTSW 12 101990003 missense probably damaging 1.00
R0510:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0626:Cpsf2 UTSW 12 101985231 missense probably benign 0.09
R0697:Cpsf2 UTSW 12 101983184 missense probably benign 0.34
R0837:Cpsf2 UTSW 12 101997242 splice site probably benign
R1475:Cpsf2 UTSW 12 101985236 missense probably damaging 1.00
R1709:Cpsf2 UTSW 12 101999542 missense probably damaging 1.00
R1974:Cpsf2 UTSW 12 101990047 missense probably benign 0.33
R1996:Cpsf2 UTSW 12 101998608 missense probably benign 0.18
R2063:Cpsf2 UTSW 12 101983463 missense probably damaging 1.00
R2164:Cpsf2 UTSW 12 101985335 missense probably damaging 1.00
R2228:Cpsf2 UTSW 12 101989829 missense probably benign 0.00
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3733:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R4627:Cpsf2 UTSW 12 101989895 missense probably benign 0.18
R4665:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4666:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4765:Cpsf2 UTSW 12 101997440 missense probably damaging 1.00
R4777:Cpsf2 UTSW 12 101996832 missense probably damaging 0.99
R4847:Cpsf2 UTSW 12 101997302 missense probably benign 0.18
R4923:Cpsf2 UTSW 12 101981984 missense probably benign
R4975:Cpsf2 UTSW 12 101983493 missense probably damaging 1.00
R5239:Cpsf2 UTSW 12 101987273 nonsense probably null
R5440:Cpsf2 UTSW 12 101996879 missense probably benign
R5601:Cpsf2 UTSW 12 101985355 splice site probably null
R5603:Cpsf2 UTSW 12 101998631 missense probably benign 0.02
R5841:Cpsf2 UTSW 12 101985238 missense probably damaging 0.99
R6153:Cpsf2 UTSW 12 101999360 splice site probably null
R6663:Cpsf2 UTSW 12 101999593 missense probably damaging 1.00
R7451:Cpsf2 UTSW 12 102000792 missense possibly damaging 0.52
R8357:Cpsf2 UTSW 12 102002670 missense probably damaging 0.99
R8457:Cpsf2 UTSW 12 102002670 missense probably damaging 0.99
V8831:Cpsf2 UTSW 12 102003141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCTGGAAACGCTTCGG -3'
(R):5'- AGGGAAGAGCTCATTTCAAGAA -3'

Sequencing Primer
(F):5'- TTCGGGGCGACGGGAAC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2015-02-05