Incidental Mutation 'R3082:Cdh6'
ID 265504
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Name cadherin 6
Synonyms K-cadherin, cad6
MMRRC Submission 040572-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.272) question?
Stock # R3082 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 13028787-13173761 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13044838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 428 (D428G)
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
AlphaFold P97326
PDB Structure Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036439
AA Change: D428G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385
AA Change: D428G

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 106,859,576 (GRCm39) V341A possibly damaging Het
Adam11 T C 11: 102,660,943 (GRCm39) probably benign Het
Aox1 G T 1: 58,322,759 (GRCm39) probably benign Het
Cep63 T C 9: 102,479,696 (GRCm39) T339A probably benign Het
Clcn1 T C 6: 42,267,112 (GRCm39) Y66H probably damaging Het
Cpsf2 C G 12: 101,955,069 (GRCm39) S280C probably damaging Het
Dcaf6 G T 1: 165,250,421 (GRCm39) probably benign Het
Ddx39a T A 8: 84,449,335 (GRCm39) N344K possibly damaging Het
Dvl1 T C 4: 155,932,316 (GRCm39) V42A possibly damaging Het
Ep400 A G 5: 110,841,096 (GRCm39) probably benign Het
Epb41l5 C T 1: 119,536,992 (GRCm39) V300I probably damaging Het
Fbln1 T G 15: 85,149,454 (GRCm39) I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Grin3a G A 4: 49,665,243 (GRCm39) R1131W probably benign Het
Incenp T A 19: 9,861,143 (GRCm39) M480L unknown Het
Ints13 G T 6: 146,476,205 (GRCm39) Q99K possibly damaging Het
L2hgdh C T 12: 69,768,858 (GRCm39) D85N probably benign Het
Lct A G 1: 128,215,345 (GRCm39) Y1744H probably damaging Het
Macf1 T C 4: 123,255,236 (GRCm39) probably null Het
Mpdz A T 4: 81,203,695 (GRCm39) probably benign Het
Naa15 T C 3: 51,367,471 (GRCm39) L498P probably damaging Het
Naip6 T A 13: 100,452,925 (GRCm39) E45D probably benign Het
Nedd4l T A 18: 65,312,049 (GRCm39) N405K probably benign Het
Or4l15 A G 14: 50,198,161 (GRCm39) Y123H probably damaging Het
Or8u10 C T 2: 85,916,053 (GRCm39) V23I probably benign Het
Pitpnc1 A G 11: 107,103,350 (GRCm39) S250P possibly damaging Het
Ppp1r18 A G 17: 36,184,742 (GRCm39) D131G probably damaging Het
Prdm5 A G 6: 65,913,069 (GRCm39) D206G probably damaging Het
Pygl A G 12: 70,244,303 (GRCm39) F455S probably damaging Het
Rictor A T 15: 6,804,338 (GRCm39) Y565F probably benign Het
Ryr1 T C 7: 28,745,071 (GRCm39) N3852D probably damaging Het
S1pr5 A T 9: 21,156,286 (GRCm39) C47S probably damaging Het
Serpinf2 T C 11: 75,328,354 (GRCm39) R65G probably benign Het
Slfn14 C T 11: 83,167,519 (GRCm39) W665* probably null Het
Smu1 T C 4: 40,745,567 (GRCm39) D251G probably damaging Het
Spata18 A G 5: 73,836,423 (GRCm39) probably benign Het
Tex19.2 A G 11: 121,007,557 (GRCm39) V297A probably benign Het
Tmem131l A G 3: 83,816,457 (GRCm39) probably null Het
Trim9 T C 12: 70,301,887 (GRCm39) R584G possibly damaging Het
Trpm7 A T 2: 126,686,342 (GRCm39) N295K possibly damaging Het
Ugt2a3 A G 5: 87,473,534 (GRCm39) V461A probably benign Het
Vmn1r45 A T 6: 89,910,724 (GRCm39) M82K probably benign Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13,034,445 (GRCm39) nonsense probably null
IGL00675:Cdh6 APN 15 13,041,525 (GRCm39) missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13,064,581 (GRCm39) missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13,051,395 (GRCm39) missense probably benign 0.40
IGL01351:Cdh6 APN 15 13,034,326 (GRCm39) missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13,034,276 (GRCm39) utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13,064,516 (GRCm39) missense possibly damaging 0.94
PIT4651001:Cdh6 UTSW 15 13,044,805 (GRCm39) missense possibly damaging 0.69
R0124:Cdh6 UTSW 15 13,034,410 (GRCm39) missense probably damaging 1.00
R0256:Cdh6 UTSW 15 13,053,868 (GRCm39) splice site probably benign
R0696:Cdh6 UTSW 15 13,051,418 (GRCm39) missense probably benign 0.36
R1017:Cdh6 UTSW 15 13,051,562 (GRCm39) missense probably benign 0.06
R1240:Cdh6 UTSW 15 13,057,541 (GRCm39) missense possibly damaging 0.48
R1444:Cdh6 UTSW 15 13,091,924 (GRCm39) missense probably benign 0.00
R2008:Cdh6 UTSW 15 13,051,562 (GRCm39) missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13,057,587 (GRCm39) missense probably benign
R2507:Cdh6 UTSW 15 13,041,447 (GRCm39) missense probably benign 0.10
R3083:Cdh6 UTSW 15 13,044,838 (GRCm39) missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13,042,661 (GRCm39) missense probably benign 0.39
R4591:Cdh6 UTSW 15 13,051,572 (GRCm39) missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13,051,418 (GRCm39) missense probably benign 0.36
R4898:Cdh6 UTSW 15 13,034,774 (GRCm39) missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13,064,497 (GRCm39) missense probably benign 0.05
R5313:Cdh6 UTSW 15 13,034,723 (GRCm39) missense probably damaging 1.00
R5545:Cdh6 UTSW 15 13,041,235 (GRCm39) missense probably damaging 1.00
R6360:Cdh6 UTSW 15 13,041,546 (GRCm39) missense possibly damaging 0.82
R6650:Cdh6 UTSW 15 13,051,487 (GRCm39) missense probably benign 0.11
R6830:Cdh6 UTSW 15 13,044,860 (GRCm39) missense probably benign 0.01
R7369:Cdh6 UTSW 15 13,042,724 (GRCm39) missense probably damaging 0.99
R7506:Cdh6 UTSW 15 13,034,396 (GRCm39) missense probably damaging 1.00
R8121:Cdh6 UTSW 15 13,044,757 (GRCm39) missense probably damaging 1.00
R8801:Cdh6 UTSW 15 13,044,847 (GRCm39) missense probably damaging 1.00
R8961:Cdh6 UTSW 15 13,041,447 (GRCm39) missense probably benign 0.12
R9218:Cdh6 UTSW 15 13,057,556 (GRCm39) missense probably null 0.37
R9258:Cdh6 UTSW 15 13,064,462 (GRCm39) missense probably damaging 1.00
R9511:Cdh6 UTSW 15 13,034,677 (GRCm39) missense probably damaging 1.00
R9608:Cdh6 UTSW 15 13,064,621 (GRCm39) missense probably damaging 1.00
R9636:Cdh6 UTSW 15 13,057,655 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAAAGCATATCTACCATGTAC -3'
(R):5'- TGCCTAGTAAGTGACTATTCAAGC -3'

Sequencing Primer
(F):5'- AAAGCATATCTACCATGTACGTATTC -3'
(R):5'- AGTAAGTGACTATTCAAGCTGATTG -3'
Posted On 2015-02-05