Incidental Mutation 'R3084:Vmn1r178'
ID265529
Institutional Source Beutler Lab
Gene Symbol Vmn1r178
Ensembl Gene ENSMUSG00000062598
Gene Namevomeronasal 1 receptor 178
SynonymsV1rd13, LOC232959
MMRRC Submission 040573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3084 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23892009-23895622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23893906 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 126 (I126M)
Ref Sequence ENSEMBL: ENSMUSP00000154244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078593] [ENSMUST00000226450] [ENSMUST00000226489] [ENSMUST00000226640] [ENSMUST00000227993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078593
AA Change: I126M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077666
Gene: ENSMUSG00000062598
AA Change: I126M

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 7.9e-11 PFAM
Pfam:7tm_1 15 283 2.5e-7 PFAM
Pfam:V1R 41 296 7.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226450
AA Change: I126M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000226489
AA Change: I53M

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000226640
AA Change: I53M

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227993
AA Change: I126M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Arhgef26 T C 3: 62,377,616 V431A probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cenpe A G 3: 135,241,021 E1099G probably damaging Het
Creb3l1 G T 2: 91,995,444 probably null Het
Cyp2c38 T C 19: 39,401,701 I352V probably benign Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Fam160a1 T A 3: 85,665,968 probably null Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5699 G T 1: 30,998,792 noncoding transcript Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Ifit3 A T 19: 34,587,240 H62L probably damaging Het
Krt34 T C 11: 100,041,021 N124S probably damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mmd C T 11: 90,266,085 R129C probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Pde6d T C 1: 86,547,526 probably null Het
Pomt1 G T 2: 32,244,240 V258L probably benign Het
Ppp2r5e T C 12: 75,468,616 I215V probably benign Het
Ranbp10 A T 8: 105,774,631 L329Q probably damaging Het
Robo1 T A 16: 73,004,737 L1083Q probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Svop T C 5: 114,042,238 T283A probably benign Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Ttf2 C T 3: 100,948,264 G872R possibly damaging Het
Vmn1r17 A G 6: 57,360,783 V199A probably damaging Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Washc2 A G 6: 116,227,493 N454S probably benign Het
Xirp2 T G 2: 67,509,049 F545V probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Vmn1r178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Vmn1r178 APN 7 23893689 missense probably damaging 0.99
IGL01781:Vmn1r178 APN 7 23894009 missense probably damaging 1.00
IGL01934:Vmn1r178 APN 7 23893937 missense probably damaging 1.00
IGL02571:Vmn1r178 APN 7 23894235 missense probably damaging 0.99
IGL02727:Vmn1r178 APN 7 23894446 unclassified probably null
IGL03112:Vmn1r178 APN 7 23893661 missense probably damaging 1.00
R0112:Vmn1r178 UTSW 7 23894184 missense possibly damaging 0.93
R0830:Vmn1r178 UTSW 7 23894027 missense possibly damaging 0.91
R1186:Vmn1r178 UTSW 7 23893892 nonsense probably null
R1340:Vmn1r178 UTSW 7 23893856 missense probably benign 0.34
R1640:Vmn1r178 UTSW 7 23894123 missense possibly damaging 0.70
R1696:Vmn1r178 UTSW 7 23894200 missense probably damaging 0.99
R1746:Vmn1r178 UTSW 7 23893904 missense probably benign 0.00
R4368:Vmn1r178 UTSW 7 23894022 missense probably damaging 1.00
R5199:Vmn1r178 UTSW 7 23894389 missense probably benign 0.11
R6380:Vmn1r178 UTSW 7 23893559 missense possibly damaging 0.62
R7000:Vmn1r178 UTSW 7 23894337 missense probably benign 0.21
R7142:Vmn1r178 UTSW 7 23893610 missense probably damaging 1.00
R7268:Vmn1r178 UTSW 7 23893953 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCCAGACAGTTGATTTTAAGCC -3'
(R):5'- TGCCTACACTGAATCCAGAAGTG -3'

Sequencing Primer
(F):5'- ACATGTCTGTGGCCAATGC -3'
(R):5'- TCCAGAAGTGAAACAGAACAACTTG -3'
Posted On2015-02-05