Incidental Mutation 'R3084:Gsg1l'
ID265531
Institutional Source Beutler Lab
Gene Symbol Gsg1l
Ensembl Gene ENSMUSG00000046182
Gene NameGSG1-like
SynonymsC230098I05Rik, G630023A01Rik
MMRRC Submission 040573-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3084 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125878420-126082411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125891680 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 284 (R284H)
Ref Sequence ENSEMBL: ENSMUSP00000073591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073935]
Predicted Effect probably benign
Transcript: ENSMUST00000073935
AA Change: R284H

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073591
Gene: ENSMUSG00000046182
AA Change: R284H

DomainStartEndE-ValueType
Pfam:GSG-1 5 122 4.9e-46 PFAM
Pfam:PMP22_Claudin 8 227 8.5e-12 PFAM
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Arhgef26 T C 3: 62,377,616 V431A probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cenpe A G 3: 135,241,021 E1099G probably damaging Het
Creb3l1 G T 2: 91,995,444 probably null Het
Cyp2c38 T C 19: 39,401,701 I352V probably benign Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Fam160a1 T A 3: 85,665,968 probably null Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5699 G T 1: 30,998,792 noncoding transcript Het
Ifit3 A T 19: 34,587,240 H62L probably damaging Het
Krt34 T C 11: 100,041,021 N124S probably damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mmd C T 11: 90,266,085 R129C probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Pde6d T C 1: 86,547,526 probably null Het
Pomt1 G T 2: 32,244,240 V258L probably benign Het
Ppp2r5e T C 12: 75,468,616 I215V probably benign Het
Ranbp10 A T 8: 105,774,631 L329Q probably damaging Het
Robo1 T A 16: 73,004,737 L1083Q probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Svop T C 5: 114,042,238 T283A probably benign Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Ttf2 C T 3: 100,948,264 G872R possibly damaging Het
Vmn1r17 A G 6: 57,360,783 V199A probably damaging Het
Vmn1r178 A G 7: 23,893,906 I126M possibly damaging Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Washc2 A G 6: 116,227,493 N454S probably benign Het
Xirp2 T G 2: 67,509,049 F545V probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Gsg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Gsg1l APN 7 125923426 missense possibly damaging 0.81
IGL01873:Gsg1l APN 7 125958443 missense probably damaging 1.00
IGL02148:Gsg1l APN 7 125923499 missense possibly damaging 0.82
IGL03076:Gsg1l APN 7 125923493 missense probably benign 0.03
R0456:Gsg1l UTSW 7 125923510 missense possibly damaging 0.67
R0513:Gsg1l UTSW 7 126020623 critical splice donor site probably null
R1771:Gsg1l UTSW 7 125958573 missense probably damaging 1.00
R1827:Gsg1l UTSW 7 125910197 missense possibly damaging 0.86
R3085:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R3086:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R4607:Gsg1l UTSW 7 125958549 missense probably damaging 1.00
R4608:Gsg1l UTSW 7 125958549 missense probably damaging 1.00
R4876:Gsg1l UTSW 7 125891669 missense probably benign 0.04
R6995:Gsg1l UTSW 7 125923486 missense probably damaging 0.96
RF016:Gsg1l UTSW 7 126020622 critical splice donor site probably null
Z1177:Gsg1l UTSW 7 126082242 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTGAATGTGCTCGGAGC -3'
(R):5'- TGCCCATATCTCAGGGTGTG -3'

Sequencing Primer
(F):5'- GGAGCCCCTAAGCTAATCTGTC -3'
(R):5'- CATATCTCAGGGTGTGGGCAAC -3'
Posted On2015-02-05