Incidental Mutation 'R3084:Ifit3'
ID 265551
Institutional Source Beutler Lab
Gene Symbol Ifit3
Ensembl Gene ENSMUSG00000074896
Gene Name interferon-induced protein with tetratricopeptide repeats 3
Synonyms Ifi49
MMRRC Submission 040573-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3084 (G1)
Quality Score 81
Status Validated
Chromosome 19
Chromosomal Location 34583531-34588731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34587240 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 62 (H62L)
Ref Sequence ENSEMBL: ENSMUSP00000099889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102825]
AlphaFold Q64345
Predicted Effect probably damaging
Transcript: ENSMUST00000102825
AA Change: H62L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099889
Gene: ENSMUSG00000074896
AA Change: H62L

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 6e-6 BLAST
low complexity region 209 218 N/A INTRINSIC
TPR 241 274 1.02e1 SMART
Meta Mutation Damage Score 0.9417 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Arhgef26 T C 3: 62,377,616 V431A probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cenpe A G 3: 135,241,021 E1099G probably damaging Het
Creb3l1 G T 2: 91,995,444 probably null Het
Cyp2c38 T C 19: 39,401,701 I352V probably benign Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Fam160a1 T A 3: 85,665,968 probably null Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5699 G T 1: 30,998,792 noncoding transcript Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Krt34 T C 11: 100,041,021 N124S probably damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mmd C T 11: 90,266,085 R129C probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Pde6d T C 1: 86,547,526 probably null Het
Pomt1 G T 2: 32,244,240 V258L probably benign Het
Ppp2r5e T C 12: 75,468,616 I215V probably benign Het
Ranbp10 A T 8: 105,774,631 L329Q probably damaging Het
Robo1 T A 16: 73,004,737 L1083Q probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Svop T C 5: 114,042,238 T283A probably benign Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Ttf2 C T 3: 100,948,264 G872R possibly damaging Het
Vmn1r17 A G 6: 57,360,783 V199A probably damaging Het
Vmn1r178 A G 7: 23,893,906 I126M possibly damaging Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Washc2 A G 6: 116,227,493 N454S probably benign Het
Xirp2 T G 2: 67,509,049 F545V probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Ifit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1501:Ifit3 UTSW 19 34588251 missense probably benign 0.13
R1521:Ifit3 UTSW 19 34587173 missense probably damaging 1.00
R5017:Ifit3 UTSW 19 34587192 missense possibly damaging 0.78
R5306:Ifit3 UTSW 19 34587807 missense probably damaging 1.00
R6194:Ifit3 UTSW 19 34587627 missense probably benign 0.06
R6523:Ifit3 UTSW 19 34588155 missense probably benign 0.10
R6559:Ifit3 UTSW 19 34587114 missense probably damaging 1.00
R7535:Ifit3 UTSW 19 34587880 missense probably damaging 0.98
R7947:Ifit3 UTSW 19 34587959 nonsense probably null
R8049:Ifit3 UTSW 19 34588080 missense possibly damaging 0.88
R8142:Ifit3 UTSW 19 34587501 missense probably damaging 1.00
R8850:Ifit3 UTSW 19 34587588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGGTCAACCGGGAATC -3'
(R):5'- CATTCCATGCTGTAAGGATTCGC -3'

Sequencing Primer
(F):5'- TCAACCGGGAATCTCTGGAAGC -3'
(R):5'- AGGATTCGCAAACTTTTGGC -3'
Posted On 2015-02-05