Incidental Mutation 'R3084:Cyp2c38'
ID 265552
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 38
Synonyms
MMRRC Submission 040573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R3084 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 39389556-39463075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39401701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 352 (I352V)
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
AlphaFold P56655
Predicted Effect probably benign
Transcript: ENSMUST00000035488
AA Change: I352V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808
AA Change: I352V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Arhgef26 T C 3: 62,377,616 V431A probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cenpe A G 3: 135,241,021 E1099G probably damaging Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Fam160a1 T A 3: 85,665,968 probably null Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5699 G T 1: 30,998,792 noncoding transcript Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Ifit3 A T 19: 34,587,240 H62L probably damaging Het
Krt34 T C 11: 100,041,021 N124S probably damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mmd C T 11: 90,266,085 R129C probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Pde6d T C 1: 86,547,526 probably null Het
Pomt1 G T 2: 32,244,240 V258L probably benign Het
Ppp2r5e T C 12: 75,468,616 I215V probably benign Het
Ranbp10 A T 8: 105,774,631 L329Q probably damaging Het
Robo1 T A 16: 73,004,737 L1083Q probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Svop T C 5: 114,042,238 T283A probably benign Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Ttf2 C T 3: 100,948,264 G872R possibly damaging Het
Vmn1r17 A G 6: 57,360,783 V199A probably damaging Het
Vmn1r178 A G 7: 23,893,906 I126M possibly damaging Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Washc2 A G 6: 116,227,493 N454S probably benign Het
Xirp2 T G 2: 67,509,049 F545V probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R0919:Cyp2c38 UTSW 19 39404669 missense probably benign 0.07
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1715:Cyp2c38 UTSW 19 39404795 missense probably benign 0.25
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6384:Cyp2c38 UTSW 19 39392293 splice site probably null
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
R7570:Cyp2c38 UTSW 19 39404743 missense possibly damaging 0.76
R7625:Cyp2c38 UTSW 19 39462924 missense possibly damaging 0.78
R7666:Cyp2c38 UTSW 19 39438242 missense possibly damaging 0.52
R8681:Cyp2c38 UTSW 19 39401691 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GATCTGCCCTCTGAACCATAAAGC -3'
(R):5'- CTTATATTGCGTTGTGTATAGCCTGAC -3'

Sequencing Primer
(F):5'- CCTGTACCACAATGTATATCAGAGG -3'
(R):5'- CGTTGTGTATAGCCTGACATTGTAAC -3'
Posted On 2015-02-05