Incidental Mutation 'R3085:Olfr1198'
ID265560
Institutional Source Beutler Lab
Gene Symbol Olfr1198
Ensembl Gene ENSMUSG00000075117
Gene Nameolfactory receptor 1198
SynonymsGA_x6K02T2Q125-50221692-50220766, MOR225-13
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88743970-88751370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88746144 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 248 (F248S)
Ref Sequence ENSEMBL: ENSMUSP00000149844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099814] [ENSMUST00000215179] [ENSMUST00000215529]
Predicted Effect probably damaging
Transcript: ENSMUST00000099814
AA Change: F248S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097402
Gene: ENSMUSG00000075117
AA Change: F248S

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.1e-49 PFAM
Pfam:7tm_1 38 284 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215179
AA Change: F248S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215529
AA Change: F248S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Olfr1198
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02290:Olfr1198 APN 2 88746385 missense probably benign
IGL02316:Olfr1198 APN 2 88746843 missense probably damaging 0.97
R0726:Olfr1198 UTSW 2 88746008 missense probably benign 0.15
R1439:Olfr1198 UTSW 2 88746834 missense possibly damaging 0.57
R1706:Olfr1198 UTSW 2 88746138 missense probably damaging 1.00
R1757:Olfr1198 UTSW 2 88746017 missense probably benign 0.15
R2202:Olfr1198 UTSW 2 88746609 missense probably benign 0.00
R2203:Olfr1198 UTSW 2 88746609 missense probably benign 0.00
R2204:Olfr1198 UTSW 2 88746609 missense probably benign 0.00
R4901:Olfr1198 UTSW 2 88746887 unclassified probably null
R4934:Olfr1198 UTSW 2 88746054 nonsense probably null
R5687:Olfr1198 UTSW 2 88746750 missense probably damaging 1.00
R6074:Olfr1198 UTSW 2 88746222 missense probably damaging 1.00
R6105:Olfr1198 UTSW 2 88746840 missense probably benign 0.01
R6781:Olfr1198 UTSW 2 88746830 missense probably benign 0.01
Z1088:Olfr1198 UTSW 2 88746578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGTCTTGGCACCACACC -3'
(R):5'- GTGGCACCAATGAAATAGACC -3'

Sequencing Primer
(F):5'- GCACCACACCTTCCTCATGG -3'
(R):5'- TGAAACTGGCCTGCACAG -3'
Posted On2015-02-05