Incidental Mutation 'R3085:Creb3l1'
ID265561
Institutional Source Beutler Lab
Gene Symbol Creb3l1
Ensembl Gene ENSMUSG00000027230
Gene NamecAMP responsive element binding protein 3-like 1
SynonymsBBF-2 (drosophila) homolog, Oasis
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91982328-92024502 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 91995444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028663]
Predicted Effect probably null
Transcript: ENSMUST00000028663
SMART Domains Protein: ENSMUSP00000028663
Gene: ENSMUSG00000027230

DomainStartEndE-ValueType
low complexity region 49 61 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
BRLZ 288 352 8.06e-19 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is normally found in the membrane of the endoplasmic reticulum (ER). However, upon stress to the ER, the encoded protein is cleaved and the released cytoplasmic transcription factor domain translocates to the nucleus. There it activates the transcription of target genes by binding to box-B elements. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, fragile skeleton, and decreased bone density, cortical and trabecular thickness, and osteoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Creb3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Creb3l1 APN 2 92024101 missense possibly damaging 0.94
IGL01963:Creb3l1 APN 2 91993333 missense probably benign 0.00
IGL02618:Creb3l1 APN 2 91983198 missense probably benign 0.00
IGL03088:Creb3l1 APN 2 91995394 missense probably benign 0.00
R0609:Creb3l1 UTSW 2 91987053 missense possibly damaging 0.93
R1891:Creb3l1 UTSW 2 91987040 missense probably damaging 1.00
R2298:Creb3l1 UTSW 2 91991976 missense probably damaging 1.00
R2912:Creb3l1 UTSW 2 91987053 missense possibly damaging 0.93
R3084:Creb3l1 UTSW 2 91995444 splice site probably null
R3151:Creb3l1 UTSW 2 92002033 missense probably damaging 0.96
R3945:Creb3l1 UTSW 2 91991211 missense probably damaging 1.00
R4175:Creb3l1 UTSW 2 91983175 missense probably benign 0.01
R4302:Creb3l1 UTSW 2 91993319 missense probably damaging 1.00
R4999:Creb3l1 UTSW 2 91983226 missense probably benign
R5035:Creb3l1 UTSW 2 91987086 missense probably benign 0.34
R5684:Creb3l1 UTSW 2 91990731 missense probably damaging 1.00
R5750:Creb3l1 UTSW 2 91986263 missense possibly damaging 0.90
R5860:Creb3l1 UTSW 2 92024054 missense probably benign 0.00
R6144:Creb3l1 UTSW 2 91992005 missense possibly damaging 0.66
R6171:Creb3l1 UTSW 2 91991269 missense probably damaging 0.99
R6239:Creb3l1 UTSW 2 91995403 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTGGGTGTGACTCCCTT -3'
(R):5'- AGCCCACCTATCTCACTTCA -3'

Sequencing Primer
(F):5'- CAGCCTTACCTGGTGAGGGATG -3'
(R):5'- TCACTTCACAAGAGTGGCCTG -3'
Posted On2015-02-05