Incidental Mutation 'R3085:Adrm1'
ID265566
Institutional Source Beutler Lab
Gene Symbol Adrm1
Ensembl Gene ENSMUSG00000039041
Gene Nameadhesion regulating molecule 1
Synonyms2510006J17Rik, Rpn13, 1110063P18Rik, Gp110, ARM-1
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180171485-180176286 bp(+) (GRCm38)
Type of Mutationsplice site (2072 bp from exon)
DNA Base Change (assembly) T to C at 180174301 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
PDB Structure LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000015791
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155357
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased birth weight, reduced competition for food, postnatal lethality, infertility, impaired sperm and oocyte development, increased peripheral CD4+ and CD8+ T cells, and increased serum GH and FSH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Adrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adrm1 APN 2 180175963 splice site probably benign
IGL02938:Adrm1 APN 2 180175602 missense probably damaging 0.98
R0718:Adrm1 UTSW 2 180175147 splice site probably benign
R1129:Adrm1 UTSW 2 180172919 unclassified probably benign
R2389:Adrm1 UTSW 2 180174323 unclassified probably benign
R2875:Adrm1 UTSW 2 180175618 missense probably damaging 0.96
R2876:Adrm1 UTSW 2 180175618 missense probably damaging 0.96
R4086:Adrm1 UTSW 2 180172834 intron probably benign
R4608:Adrm1 UTSW 2 180174855 splice site probably benign
R5416:Adrm1 UTSW 2 180176137 missense probably benign 0.06
R5536:Adrm1 UTSW 2 180172188 unclassified probably benign
R5575:Adrm1 UTSW 2 180175716 missense probably benign 0.00
R8026:Adrm1 UTSW 2 180175209 missense unknown
R8677:Adrm1 UTSW 2 180172039 missense probably benign 0.06
Z1177:Adrm1 UTSW 2 180174915 missense unknown
Z1177:Adrm1 UTSW 2 180175372 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GGGCATTGTCCTTCAGTGAC -3'
(R):5'- ATGGCTGAGAGAAAACCCCG -3'

Sequencing Primer
(F):5'- CAGAGCCTGCTTGATAAGTTCTG -3'
(R):5'- CTGAGAGAAAACCCCGGGTCTG -3'
Posted On2015-02-05