Incidental Mutation 'R3085:Igdcc4'
ID265588
Institutional Source Beutler Lab
Gene Symbol Igdcc4
Ensembl Gene ENSMUSG00000032816
Gene Nameimmunoglobulin superfamily, DCC subclass, member 4
SynonymsWI-18508, WI-16786, Nope, 9330155G14Rik
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65101486-65137940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65132058 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 947 (F947S)
Ref Sequence ENSEMBL: ENSMUSP00000045387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035499] [ENSMUST00000077696] [ENSMUST00000166273] [ENSMUST00000213533]
Predicted Effect probably damaging
Transcript: ENSMUST00000035499
AA Change: F947S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045387
Gene: ENSMUSG00000032816
AA Change: F947S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 318 1.13e-11 SMART
low complexity region 322 335 N/A INTRINSIC
IGc2 346 411 1.34e-13 SMART
FN3 428 511 3.58e-12 SMART
FN3 526 610 9.54e-8 SMART
FN3 630 726 7.34e-9 SMART
FN3 750 832 1.05e-9 SMART
FN3 848 932 2.14e-10 SMART
low complexity region 958 978 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1154 1168 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077696
AA Change: F993S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076878
Gene: ENSMUSG00000032816
AA Change: F993S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 458 7.02e-8 SMART
FN3 475 558 3.58e-12 SMART
FN3 573 656 1.1e-7 SMART
FN3 676 772 7.34e-9 SMART
FN3 796 878 1.05e-9 SMART
FN3 894 978 2.14e-10 SMART
low complexity region 1004 1024 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
low complexity region 1200 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166273
SMART Domains Protein: ENSMUSP00000132576
Gene: ENSMUSG00000032816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 40 83 3e-22 BLAST
low complexity region 142 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213423
Predicted Effect probably benign
Transcript: ENSMUST00000213533
AA Change: F946S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214978
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Igdcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Igdcc4 APN 9 65135164 missense probably damaging 1.00
IGL01285:Igdcc4 APN 9 65123991 missense probably damaging 1.00
IGL01412:Igdcc4 APN 9 65114449 splice site probably benign
IGL01485:Igdcc4 APN 9 65122607 missense probably benign 0.02
IGL01552:Igdcc4 APN 9 65122502 intron probably benign
IGL01651:Igdcc4 APN 9 65124112 missense possibly damaging 0.63
IGL01751:Igdcc4 APN 9 65131732 missense probably damaging 1.00
IGL02164:Igdcc4 APN 9 65124782 splice site probably benign
IGL02468:Igdcc4 APN 9 65126832 missense probably damaging 1.00
IGL02616:Igdcc4 APN 9 65133078 missense probably damaging 1.00
IGL02685:Igdcc4 APN 9 65133825 missense possibly damaging 0.81
IGL02734:Igdcc4 APN 9 65131456 missense possibly damaging 0.47
IGL02893:Igdcc4 APN 9 65133071 missense probably damaging 1.00
R0006:Igdcc4 UTSW 9 65135100 splice site probably benign
R0583:Igdcc4 UTSW 9 65121813 missense possibly damaging 0.85
R0939:Igdcc4 UTSW 9 65131473 critical splice donor site probably null
R1075:Igdcc4 UTSW 9 65131650 missense possibly damaging 0.90
R1110:Igdcc4 UTSW 9 65126926 missense possibly damaging 0.91
R1183:Igdcc4 UTSW 9 65121900 missense possibly damaging 0.91
R1318:Igdcc4 UTSW 9 65133690 missense probably damaging 1.00
R1507:Igdcc4 UTSW 9 65133744 missense probably damaging 1.00
R1548:Igdcc4 UTSW 9 65135227 missense probably benign 0.08
R1640:Igdcc4 UTSW 9 65122795 missense probably damaging 1.00
R1681:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R1687:Igdcc4 UTSW 9 65131663 missense probably damaging 1.00
R1716:Igdcc4 UTSW 9 65126897 missense probably damaging 1.00
R1964:Igdcc4 UTSW 9 65122769 missense probably benign
R1996:Igdcc4 UTSW 9 65121819 missense probably damaging 1.00
R2150:Igdcc4 UTSW 9 65125335 missense possibly damaging 0.92
R2278:Igdcc4 UTSW 9 65130743 missense probably damaging 1.00
R4011:Igdcc4 UTSW 9 65135479 missense probably benign
R4077:Igdcc4 UTSW 9 65131765 missense probably damaging 1.00
R4191:Igdcc4 UTSW 9 65124151 missense probably benign 0.13
R4293:Igdcc4 UTSW 9 65124610 critical splice acceptor site probably null
R4589:Igdcc4 UTSW 9 65130628 missense probably damaging 1.00
R4931:Igdcc4 UTSW 9 65124015 missense possibly damaging 0.66
R5093:Igdcc4 UTSW 9 65122757 missense possibly damaging 0.51
R5106:Igdcc4 UTSW 9 65124701 missense probably damaging 1.00
R5546:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R5634:Igdcc4 UTSW 9 65134546 missense probably benign 0.18
R5810:Igdcc4 UTSW 9 65128695 missense probably damaging 1.00
R6395:Igdcc4 UTSW 9 65135118 missense probably damaging 1.00
R6475:Igdcc4 UTSW 9 65120321 missense probably damaging 1.00
R6776:Igdcc4 UTSW 9 65135418 missense probably benign 0.02
R6828:Igdcc4 UTSW 9 65122697 missense probably benign
R6914:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R6942:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R7072:Igdcc4 UTSW 9 65130731 missense probably damaging 1.00
R7234:Igdcc4 UTSW 9 65135468 nonsense probably null
R7448:Igdcc4 UTSW 9 65123994 missense possibly damaging 0.52
R7562:Igdcc4 UTSW 9 65124024 missense probably damaging 1.00
R7607:Igdcc4 UTSW 9 65133758 missense possibly damaging 0.85
R7734:Igdcc4 UTSW 9 65131753 missense probably damaging 0.99
R7807:Igdcc4 UTSW 9 65133795 missense probably benign 0.00
R7852:Igdcc4 UTSW 9 65120258 missense probably benign 0.04
R7904:Igdcc4 UTSW 9 65134519 missense probably benign 0.00
R8133:Igdcc4 UTSW 9 65131741 missense possibly damaging 0.54
R8147:Igdcc4 UTSW 9 65123971 missense probably benign 0.42
R8230:Igdcc4 UTSW 9 65122738 missense probably damaging 1.00
R8822:Igdcc4 UTSW 9 65124016 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAAAGTTGGTTTGCCCATGG -3'
(R):5'- CCTTCGCATATGCACTGTGC -3'

Sequencing Primer
(F):5'- GCCCATGGTGCTTTGGC -3'
(R):5'- TTCGCATATGCACTGTGCCAAAC -3'
Posted On2015-02-05