Incidental Mutation 'R3085:Dyx1c1'
ID265589
Institutional Source Beutler Lab
Gene Symbol Dyx1c1
Ensembl Gene ENSMUSG00000092192
Gene Namedyslexia susceptibility 1 candidate 1
Synonyms1700010I24Rik, b2b811Clo, EKN1
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72958785-72973064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72972406 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 289 (N289K)
Ref Sequence ENSEMBL: ENSMUSP00000096166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034734] [ENSMUST00000098567] [ENSMUST00000149692]
Predicted Effect probably benign
Transcript: ENSMUST00000034734
AA Change: N409K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034734
Gene: ENSMUSG00000092192
AA Change: N409K

DomainStartEndE-ValueType
Pfam:CS 6 77 5.8e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
TPR 288 321 2.56e1 SMART
TPR 322 355 1.26e-1 SMART
TPR 364 397 2.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098567
AA Change: N289K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096166
Gene: ENSMUSG00000092192
AA Change: N289K

DomainStartEndE-ValueType
Pfam:CS 6 77 1.3e-14 PFAM
TPR 168 201 2.56e1 SMART
TPR 202 235 1.26e-1 SMART
TPR 244 277 2.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193501
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit both pre- and postnatal lethality, hydrocephalus, and defects in organ laterality and ciliary motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Dyx1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dyx1c1 APN 9 72969066 missense probably benign 0.02
R0211:Dyx1c1 UTSW 9 72961367 missense possibly damaging 0.82
R0310:Dyx1c1 UTSW 9 72972336 missense probably damaging 1.00
R0712:Dyx1c1 UTSW 9 72960657 nonsense probably null
R1791:Dyx1c1 UTSW 9 72960684 missense possibly damaging 0.90
R1927:Dyx1c1 UTSW 9 72960627 missense probably damaging 0.98
R4624:Dyx1c1 UTSW 9 72964171 missense probably benign 0.01
R4998:Dyx1c1 UTSW 9 72960678 missense possibly damaging 0.93
R5008:Dyx1c1 UTSW 9 72972318 intron probably benign
R5200:Dyx1c1 UTSW 9 72972431 missense probably damaging 1.00
R5256:Dyx1c1 UTSW 9 72972080 critical splice donor site probably null
R5806:Dyx1c1 UTSW 9 72962054 missense probably benign 0.06
R5930:Dyx1c1 UTSW 9 72971998 missense probably damaging 1.00
R6751:Dyx1c1 UTSW 9 72961975 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGAGACCCTGTTTCAGAAAGAC -3'
(R):5'- ACTCAAACAGCCTGTTCTCTGG -3'

Sequencing Primer
(F):5'- CCCTGTTTCAGAAAGACAAAAAGTTG -3'
(R):5'- TGGCCTCAAGCTCATAGAGACTTG -3'
Posted On2015-02-05