Incidental Mutation 'R3085:Fbxw13'
ID265590
Institutional Source Beutler Lab
Gene Symbol Fbxw13
Ensembl Gene ENSMUSG00000049314
Gene NameF-box and WD-40 domain protein 13
Synonyms
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109179227-109195975 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 109184231 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 130 (G130*)
Ref Sequence ENSEMBL: ENSMUSP00000142352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061456] [ENSMUST00000199102] [ENSMUST00000199118]
Predicted Effect probably null
Transcript: ENSMUST00000061456
AA Change: G213*
SMART Domains Protein: ENSMUSP00000053786
Gene: ENSMUSG00000049314
AA Change: G213*

DomainStartEndE-ValueType
FBOX 5 45 9.33e-5 SMART
SCOP:d1gxra_ 128 249 8e-7 SMART
Blast:WD40 137 176 2e-7 BLAST
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199102
AA Change: G130*
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314
AA Change: G130*

DomainStartEndE-ValueType
SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199118
SMART Domains Protein: ENSMUSP00000143174
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
FBOX 5 45 3.25e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Fbxw13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Fbxw13 APN 9 109181416 missense probably damaging 0.99
IGL02455:Fbxw13 APN 9 109183187 missense probably benign 0.26
IGL03154:Fbxw13 APN 9 109181465 missense probably damaging 0.96
R0304:Fbxw13 UTSW 9 109194721 missense probably benign 0.02
R1259:Fbxw13 UTSW 9 109185371 missense probably damaging 1.00
R1710:Fbxw13 UTSW 9 109181518 missense probably damaging 1.00
R1912:Fbxw13 UTSW 9 109181543 missense probably benign 0.10
R2877:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R2878:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R4321:Fbxw13 UTSW 9 109181435 missense probably benign 0.10
R4969:Fbxw13 UTSW 9 109181524 unclassified probably null
R5024:Fbxw13 UTSW 9 109179335 missense probably benign 0.00
R5450:Fbxw13 UTSW 9 109184157 missense probably benign 0.41
R5957:Fbxw13 UTSW 9 109192666 critical splice donor site probably null
R6801:Fbxw13 UTSW 9 109194727 missense probably null 1.00
R7710:Fbxw13 UTSW 9 109195900 missense probably damaging 1.00
X0065:Fbxw13 UTSW 9 109192708 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGAGTTGCTAGAACACACC -3'
(R):5'- TTGATGTCCCAGTGAGTCCTG -3'

Sequencing Primer
(F):5'- CACCTACCTTTGGCAAGATATGTGG -3'
(R):5'- CCTACCTCATTTGTTTGAGACAGAG -3'
Posted On2015-02-05