Incidental Mutation 'R3085:Synpo2l'
ID265606
Institutional Source Beutler Lab
Gene Symbol Synpo2l
Ensembl Gene ENSMUSG00000039376
Gene Namesynaptopodin 2-like
Synonyms1110054M18Rik, Chap
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20658946-20668354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20662180 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 350 (D350G)
Ref Sequence ENSEMBL: ENSMUSP00000053176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057090] [ENSMUST00000117386] [ENSMUST00000119483]
Predicted Effect probably damaging
Transcript: ENSMUST00000057090
AA Change: D350G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053176
Gene: ENSMUSG00000039376
AA Change: D350G

DomainStartEndE-ValueType
PDZ 15 85 3.52e-10 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 151 162 N/A INTRINSIC
low complexity region 202 230 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
low complexity region 700 726 N/A INTRINSIC
low complexity region 781 797 N/A INTRINSIC
low complexity region 867 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117386
AA Change: D353G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112792
Gene: ENSMUSG00000039376
AA Change: D353G

DomainStartEndE-ValueType
PDZ 15 88 1.34e-15 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
low complexity region 503 521 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 566 583 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 703 729 N/A INTRINSIC
low complexity region 784 800 N/A INTRINSIC
low complexity region 870 883 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119483
AA Change: D124G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112760
Gene: ENSMUSG00000039376
AA Change: D124G

DomainStartEndE-ValueType
low complexity region 203 218 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 474 500 N/A INTRINSIC
low complexity region 555 571 N/A INTRINSIC
low complexity region 641 654 N/A INTRINSIC
Meta Mutation Damage Score 0.1666 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Synpo2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Synpo2l UTSW 14 20666272 unclassified probably benign
R0277:Synpo2l UTSW 14 20661788 missense probably damaging 1.00
R0440:Synpo2l UTSW 14 20661398 missense possibly damaging 0.89
R0540:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0607:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0712:Synpo2l UTSW 14 20661839 missense probably damaging 1.00
R1175:Synpo2l UTSW 14 20668167 missense possibly damaging 0.93
R1563:Synpo2l UTSW 14 20661278 missense probably damaging 1.00
R1729:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1730:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1739:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R2199:Synpo2l UTSW 14 20661919 missense probably benign 0.00
R2213:Synpo2l UTSW 14 20660666 missense probably damaging 1.00
R4787:Synpo2l UTSW 14 20661697 missense possibly damaging 0.49
R5256:Synpo2l UTSW 14 20661014 missense probably benign 0.00
R5454:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5455:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5765:Synpo2l UTSW 14 20666130 missense possibly damaging 0.95
R5950:Synpo2l UTSW 14 20665935 missense probably benign 0.00
R6376:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R6438:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R6440:Synpo2l UTSW 14 20668176 missense probably damaging 0.98
R6511:Synpo2l UTSW 14 20662450 missense probably damaging 1.00
R6834:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R7735:Synpo2l UTSW 14 20661175 missense possibly damaging 0.88
R7968:Synpo2l UTSW 14 20666802 splice site probably null
R8250:Synpo2l UTSW 14 20662276 missense probably benign 0.03
R8282:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R8359:Synpo2l UTSW 14 20666140 missense probably benign
R8771:Synpo2l UTSW 14 20660423 missense probably damaging 0.98
Z1088:Synpo2l UTSW 14 20665967 missense probably damaging 0.99
Z1177:Synpo2l UTSW 14 20660504 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGCCCATTAAGCATAGCTG -3'
(R):5'- AAATGCCGGACCATTGCATCC -3'

Sequencing Primer
(F):5'- ATAGCTGCTGGGCCCAC -3'
(R):5'- CTCACTCCAAGGGGGTGCTTATG -3'
Posted On2015-02-05