Incidental Mutation 'R3085:Nrg3'
ID265607
Institutional Source Beutler Lab
Gene Symbol Nrg3
Ensembl Gene ENSMUSG00000041014
Gene Nameneuregulin 3
Synonymsska
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location38368952-39473088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38370949 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 560 (D560Y)
Ref Sequence ENSEMBL: ENSMUSP00000129783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166968] [ENSMUST00000168810] [ENSMUST00000173780]
Predicted Effect probably damaging
Transcript: ENSMUST00000166968
AA Change: D576Y

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136884
Gene: ENSMUSG00000041014
AA Change: D576Y

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
Pfam:Neuregulin 355 480 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168810
AA Change: D560Y

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129783
Gene: ENSMUSG00000041014
AA Change: D560Y

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173780
AA Change: D552Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134727
Gene: ENSMUSG00000041014
AA Change: D552Y

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuregulin gene family. This gene family encodes ligands for the transmembrane tyrosine kinase receptors ERBB3 and ERBB4 - members of the epidermal growth factor receptor family. Ligand binding activates intracellular signaling cascades and the induction of cellular responses including proliferation, migration, differentiation, and survival or apoptosis. This gene encodes neuregulin 3 (NRG3). NRG3 has been shown to activate the tyrosine phosphorylation of its cognate receptor, ERBB4, and is thought to influence neuroblast proliferation, migration and differentiation by signalling through ERBB4. NRG3 also promotes mammary differentiation during embryogenesis. Linkage studies have implicated this gene as a susceptibility locus for schizophrenia and schizoaffective disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but their biological validity has not been verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mutations in this gene result in abnormal, genetic background specific, mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Nrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Nrg3 APN 14 38370801 missense probably damaging 0.99
IGL01994:Nrg3 APN 14 39012086 missense probably damaging 1.00
IGL02002:Nrg3 APN 14 38370767 nonsense probably null
IGL02247:Nrg3 APN 14 38371312 missense probably damaging 0.98
IGL02967:Nrg3 APN 14 38668299 splice site probably benign
R6803_Nrg3_459 UTSW 14 39012000 nonsense probably null
FR4304:Nrg3 UTSW 14 38397273 small insertion probably benign
FR4449:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4548:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4589:Nrg3 UTSW 14 38397266 small insertion probably benign
R0178:Nrg3 UTSW 14 38376456 missense probably damaging 1.00
R0825:Nrg3 UTSW 14 39472391 missense possibly damaging 0.67
R1545:Nrg3 UTSW 14 38407154 missense probably benign 0.03
R2009:Nrg3 UTSW 14 38370814 missense probably damaging 0.99
R2022:Nrg3 UTSW 14 38376352 missense probably damaging 0.98
R2264:Nrg3 UTSW 14 38381702 missense probably damaging 1.00
R2937:Nrg3 UTSW 14 38371008 missense possibly damaging 0.94
R2958:Nrg3 UTSW 14 39472712 missense unknown
R3801:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R3803:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R4246:Nrg3 UTSW 14 39472241 missense possibly damaging 0.58
R5584:Nrg3 UTSW 14 39472697 small deletion probably benign
R5625:Nrg3 UTSW 14 38370993 missense probably damaging 0.99
R5870:Nrg3 UTSW 14 39472629 missense possibly damaging 0.95
R6007:Nrg3 UTSW 14 39472452 nonsense probably null
R6047:Nrg3 UTSW 14 38397352 critical splice acceptor site probably null
R6294:Nrg3 UTSW 14 38397239 missense probably benign 0.00
R6803:Nrg3 UTSW 14 39012000 nonsense probably null
R7023:Nrg3 UTSW 14 38376376 missense probably damaging 1.00
R7159:Nrg3 UTSW 14 38370735 nonsense probably null
R7194:Nrg3 UTSW 14 39472478 missense probably benign 0.17
R7297:Nrg3 UTSW 14 38370939 missense probably benign 0.10
R7413:Nrg3 UTSW 14 38370712 missense probably damaging 0.99
R7474:Nrg3 UTSW 14 39011999 missense probably damaging 0.98
R7684:Nrg3 UTSW 14 39472565 missense probably damaging 1.00
R7848:Nrg3 UTSW 14 38668283 missense probably damaging 1.00
R8342:Nrg3 UTSW 14 39012096 missense probably damaging 1.00
R8435:Nrg3 UTSW 14 39472697 small deletion probably benign
R8797:Nrg3 UTSW 14 38371286 missense probably benign 0.20
X0020:Nrg3 UTSW 14 38397241 missense probably benign 0.01
Z1176:Nrg3 UTSW 14 39472533 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCATACTCGCGTTGACAATG -3'
(R):5'- GGAAGACTATATCCCACCTGCC -3'

Sequencing Primer
(F):5'- ATACTCGCGTTGACAATGTCAGC -3'
(R):5'- TGTGACCTTGAGCAAGTCAC -3'
Posted On2015-02-05