Incidental Mutation 'R3086:Stk-ps2'
ID265617
Institutional Source Beutler Lab
Gene Symbol Stk-ps2
Ensembl Gene ENSMUSG00000044457
Gene Nameserine/threonine kinase 2
SynonymsGm4776
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46020072-46030469 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 46029076 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051224
SMART Domains Protein: ENSMUSP00000054781
Gene: ENSMUSG00000044457

DomainStartEndE-ValueType
S_TKc 14 262 5.9e-85 SMART
UBA 276 313 8.44e-4 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167676
SMART Domains Protein: ENSMUSP00000133145
Gene: ENSMUSG00000044457

DomainStartEndE-ValueType
S_TKc 14 262 5.9e-85 SMART
UBA 276 313 8.44e-4 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171707
SMART Domains Protein: ENSMUSP00000125766
Gene: ENSMUSG00000044457

DomainStartEndE-ValueType
S_TKc 14 262 5.9e-85 SMART
UBA 276 313 8.44e-4 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187808
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Stk-ps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Stk-ps2 APN 1 46029850 exon noncoding transcript
IGL01662:Stk-ps2 APN 1 46029362 unclassified noncoding transcript
IGL01859:Stk-ps2 APN 1 46030042 exon noncoding transcript
IGL01949:Stk-ps2 APN 1 46029988 exon noncoding transcript
IGL02338:Stk-ps2 APN 1 46030177 exon noncoding transcript
R0087:Stk-ps2 UTSW 1 46029889 exon noncoding transcript
R0139:Stk-ps2 UTSW 1 46029795 exon noncoding transcript
R0627:Stk-ps2 UTSW 1 46029691 exon noncoding transcript
R3763:Stk-ps2 UTSW 1 46029921 exon noncoding transcript
R4817:Stk-ps2 UTSW 1 46028965 unclassified noncoding transcript
R4951:Stk-ps2 UTSW 1 46029442 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCAAGCCCTGATTCTCTTGC -3'
(R):5'- TCTATCATCTCAGCCAAGCCTG -3'

Sequencing Primer
(F):5'- GCTCATTCTCTTGAAGCGGCTG -3'
(R):5'- ATCTCAGCCAAGCCTGTGGATC -3'
Posted On2015-02-05