Incidental Mutation 'R3086:Orc4'
ID265619
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48937489 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 31 (P31S)
Ref Sequence ENSEMBL: ENSMUSP00000088497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000123271] [ENSMUST00000142851] [ENSMUST00000149679]
Predicted Effect probably benign
Transcript: ENSMUST00000028098
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090976
AA Change: P31S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
Pfam:AAA_16 34 138 3.3e-14 PFAM
Pfam:KAP_NTPase 38 123 2.9e-7 PFAM
Pfam:Arch_ATPase 43 130 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123271
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect probably benign
Transcript: ENSMUST00000142851
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149679
AA Change: P31S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121114
Gene: ENSMUSG00000026761
AA Change: P31S

DomainStartEndE-ValueType
SCOP:d1jbka_ 43 73 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
R7572:Orc4 UTSW 2 48910236 missense probably benign 0.01
R7938:Orc4 UTSW 2 48910191 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCAGGTGTTAAGTACCAGAATTC -3'
(R):5'- GTTCTGCCATTCACTGACGTG -3'

Sequencing Primer
(F):5'- ACCAGAATTCTTTCAATAATAGCAGG -3'
(R):5'- GACGTGACATCTCATTATTTACCTG -3'
Posted On2015-02-05