Incidental Mutation 'R3086:Adgra3'
ID265629
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 50013391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971] [ENSMUST00000030971] [ENSMUST00000030971]
Predicted Effect probably null
Transcript: ENSMUST00000030971
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030971
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030971
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196229
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
R7026:Adgra3 UTSW 5 49960741 missense probably benign
R7147:Adgra3 UTSW 5 49961245 missense probably damaging 1.00
R7206:Adgra3 UTSW 5 50006896 missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50058774 start codon destroyed probably null
R7508:Adgra3 UTSW 5 50016867 missense probably benign 0.10
R7538:Adgra3 UTSW 5 49961450 missense probably benign 0.01
R7579:Adgra3 UTSW 5 49987635 missense probably benign
R7951:Adgra3 UTSW 5 49963784 missense probably damaging 1.00
R8269:Adgra3 UTSW 5 49963737 missense probably damaging 0.98
R8458:Adgra3 UTSW 5 49987671 missense probably damaging 0.99
RF005:Adgra3 UTSW 5 50013387 splice site probably null
RF024:Adgra3 UTSW 5 50013387 splice site probably null
RF036:Adgra3 UTSW 5 50058641 small deletion probably benign
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAGGGATTCTGAACCCATCTTC -3'
(R):5'- TCTGGAGTGCCCTTCGTATC -3'

Sequencing Primer
(F):5'- CTGTTCTGAGGACACTGCATC -3'
(R):5'- CCTTCGTATCTCGCTTGAGGAAG -3'
Posted On2015-02-05