Incidental Mutation 'R3086:Zfp780b'
ID265634
Institutional Source Beutler Lab
Gene Symbol Zfp780b
Ensembl Gene ENSMUSG00000063047
Gene Namezinc finger protein 780B
SynonymsB230208L21Rik
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27959135-27979171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27963630 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 500 (I500T)
Ref Sequence ENSEMBL: ENSMUSP00000146224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081618] [ENSMUST00000205874] [ENSMUST00000206685]
Predicted Effect probably damaging
Transcript: ENSMUST00000081618
AA Change: I500T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080324
Gene: ENSMUSG00000063047
AA Change: I500T

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 171 193 2.91e-2 SMART
ZnF_C2H2 199 221 3.44e-4 SMART
ZnF_C2H2 227 249 3.11e-2 SMART
ZnF_C2H2 255 277 2.4e-3 SMART
ZnF_C2H2 283 305 2.15e-5 SMART
ZnF_C2H2 311 333 1.18e-2 SMART
ZnF_C2H2 339 361 1.47e-3 SMART
ZnF_C2H2 367 389 1.79e-2 SMART
ZnF_C2H2 395 417 2.24e-3 SMART
ZnF_C2H2 423 445 7.9e-4 SMART
ZnF_C2H2 451 473 8.34e-3 SMART
ZnF_C2H2 479 501 7.9e-4 SMART
ZnF_C2H2 507 529 3.16e-3 SMART
ZnF_C2H2 535 557 1.58e-3 SMART
ZnF_C2H2 563 585 9.08e-4 SMART
ZnF_C2H2 591 613 1.36e-2 SMART
ZnF_C2H2 619 641 1.04e-3 SMART
ZnF_C2H2 647 669 1.2e-3 SMART
ZnF_C2H2 675 697 2.24e-3 SMART
ZnF_C2H2 703 725 1.03e-2 SMART
ZnF_C2H2 731 753 4.17e-3 SMART
ZnF_C2H2 759 781 1.78e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205874
Predicted Effect probably damaging
Transcript: ENSMUST00000206685
AA Change: I500T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.3207 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Zfp780b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Zfp780b APN 7 27964761 missense probably benign
IGL03088:Zfp780b APN 7 27962992 missense possibly damaging 0.84
IGL03211:Zfp780b APN 7 27963175 missense possibly damaging 0.93
R0403:Zfp780b UTSW 7 27971689 missense possibly damaging 0.47
R1458:Zfp780b UTSW 7 27964827 missense probably damaging 0.99
R1550:Zfp780b UTSW 7 27964857 missense probably benign
R1694:Zfp780b UTSW 7 27964383 missense possibly damaging 0.86
R1823:Zfp780b UTSW 7 27963100 missense possibly damaging 0.93
R2113:Zfp780b UTSW 7 27963873 missense possibly damaging 0.85
R4620:Zfp780b UTSW 7 27962753 nonsense probably null
R5023:Zfp780b UTSW 7 27963448 missense possibly damaging 0.88
R5521:Zfp780b UTSW 7 27974748 splice site probably null
R5582:Zfp780b UTSW 7 27964827 missense probably damaging 0.99
R5677:Zfp780b UTSW 7 27962799 missense probably benign 0.33
R5762:Zfp780b UTSW 7 27964818 missense probably benign
R5998:Zfp780b UTSW 7 27964622 missense probably benign 0.07
R6036:Zfp780b UTSW 7 27963568 missense probably damaging 0.99
R6036:Zfp780b UTSW 7 27963568 missense probably damaging 0.99
R6050:Zfp780b UTSW 7 27964302 missense probably damaging 0.98
R6702:Zfp780b UTSW 7 27971641 missense possibly damaging 0.91
R6703:Zfp780b UTSW 7 27971641 missense possibly damaging 0.91
R7112:Zfp780b UTSW 7 27963141 missense probably damaging 0.98
R7311:Zfp780b UTSW 7 27963163 missense possibly damaging 0.92
R7469:Zfp780b UTSW 7 27963957 missense probably benign 0.02
R7561:Zfp780b UTSW 7 27964612 missense possibly damaging 0.92
R7847:Zfp780b UTSW 7 27964418 missense probably benign 0.00
R7930:Zfp780b UTSW 7 27964418 missense probably benign 0.00
X0024:Zfp780b UTSW 7 27963250 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCTTGCACTCAAAGGGTC -3'
(R):5'- CCACACAAGTGTAATGAGTGTGG -3'

Sequencing Primer
(F):5'- TGCACTCAAAGGGTCTGTTAC -3'
(R):5'- TTTAAAAGAAGCAAAAGCCTCATGC -3'
Posted On2015-02-05