Incidental Mutation 'R3086:Gsg1l'
ID265635
Institutional Source Beutler Lab
Gene Symbol Gsg1l
Ensembl Gene ENSMUSG00000046182
Gene NameGSG1-like
SynonymsC230098I05Rik, G630023A01Rik
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125878420-126082411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125891680 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 284 (R284H)
Ref Sequence ENSEMBL: ENSMUSP00000073591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073935]
Predicted Effect probably benign
Transcript: ENSMUST00000073935
AA Change: R284H

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073591
Gene: ENSMUSG00000046182
AA Change: R284H

DomainStartEndE-ValueType
Pfam:GSG-1 5 122 4.9e-46 PFAM
Pfam:PMP22_Claudin 8 227 8.5e-12 PFAM
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Gsg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Gsg1l APN 7 125923426 missense possibly damaging 0.81
IGL01873:Gsg1l APN 7 125958443 missense probably damaging 1.00
IGL02148:Gsg1l APN 7 125923499 missense possibly damaging 0.82
IGL03076:Gsg1l APN 7 125923493 missense probably benign 0.03
R0456:Gsg1l UTSW 7 125923510 missense possibly damaging 0.67
R0513:Gsg1l UTSW 7 126020623 critical splice donor site probably null
R1771:Gsg1l UTSW 7 125958573 missense probably damaging 1.00
R1827:Gsg1l UTSW 7 125910197 missense possibly damaging 0.86
R3084:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R3085:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R4607:Gsg1l UTSW 7 125958549 missense probably damaging 1.00
R4608:Gsg1l UTSW 7 125958549 missense probably damaging 1.00
R4876:Gsg1l UTSW 7 125891669 missense probably benign 0.04
R6995:Gsg1l UTSW 7 125923486 missense probably damaging 0.96
RF016:Gsg1l UTSW 7 126020622 critical splice donor site probably null
Z1177:Gsg1l UTSW 7 126082242 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAAGTGAATGTGCTCGGAG -3'
(R):5'- TGCCCATATCTCAGGGTGTG -3'

Sequencing Primer
(F):5'- GGAGCCCCTAAGCTAATCTGTC -3'
(R):5'- CATATCTCAGGGTGTGGGCAAC -3'
Posted On2015-02-05