Incidental Mutation 'R3086:Zfyve26'
ID 265645
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Name zinc finger, FYVE domain containing 26
Synonyms A630028O16Rik, 9330197E15Rik, LOC380767
MMRRC Submission 040575-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3086 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 79279120-79343078 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 79312457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]
AlphaFold Q5DU37
Predicted Effect probably benign
Transcript: ENSMUST00000021547
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Predicted Effect probably benign
Transcript: ENSMUST00000219912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220262
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 47,083,881 (GRCm39) L48P probably damaging Het
Adgra3 A T 5: 50,170,733 (GRCm39) probably null Het
Alms1 A G 6: 85,655,122 (GRCm39) R3223G probably benign Het
Bltp1 A G 3: 37,065,852 (GRCm39) D3483G possibly damaging Het
Cabyr T C 18: 12,884,023 (GRCm39) V170A probably damaging Het
Ces2b A T 8: 105,559,401 (GRCm39) D89V possibly damaging Het
Dhrs2 G T 14: 55,477,301 (GRCm39) V179L probably benign Het
Dlg5 T C 14: 24,216,258 (GRCm39) T595A probably damaging Het
Dock10 T C 1: 80,510,074 (GRCm39) N1585D possibly damaging Het
Dock4 T C 12: 40,781,862 (GRCm39) I689T probably benign Het
Fgfr4 G T 13: 55,315,205 (GRCm39) probably benign Het
Frk G A 10: 34,483,950 (GRCm39) G437D probably damaging Het
Frzb T G 2: 80,248,858 (GRCm39) I199L possibly damaging Het
Gsg1l C T 7: 125,490,852 (GRCm39) R284H probably benign Het
Helq A G 5: 100,921,858 (GRCm39) L782S probably benign Het
Kif20b T C 19: 34,907,115 (GRCm39) F128S probably damaging Het
Kifc2 T C 15: 76,551,452 (GRCm39) F725L probably benign Het
Lekr1 A G 3: 65,634,581 (GRCm39) noncoding transcript Het
Macf1 T A 4: 123,328,901 (GRCm39) M2490L probably benign Het
Megf8 T A 7: 25,048,444 (GRCm39) Y1706N probably damaging Het
N4bp2 A G 5: 65,948,396 (GRCm39) Y342C probably damaging Het
Nf1 T C 11: 79,437,812 (GRCm39) C2057R probably damaging Het
Or4f60 C A 2: 111,902,320 (GRCm39) G203* probably null Het
Or4k36 A G 2: 111,146,461 (GRCm39) I212M probably benign Het
Or6c88 G A 10: 129,407,276 (GRCm39) G251S probably damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pcdha1 G C 18: 37,064,001 (GRCm39) E222Q possibly damaging Het
Prune2 A T 19: 17,098,777 (GRCm39) D1427V possibly damaging Het
Rnps1 C T 17: 24,631,393 (GRCm39) probably benign Het
Rsph4a G C 10: 33,785,198 (GRCm39) V370L probably damaging Het
Sema5b T A 16: 35,443,093 (GRCm39) S33T probably benign Het
Stk-ps2 A C 1: 46,068,236 (GRCm39) noncoding transcript Het
Tep1 A T 14: 51,064,511 (GRCm39) probably null Het
Tet1 T C 10: 62,715,400 (GRCm39) K132E probably benign Het
Tiam2 A G 17: 3,471,857 (GRCm39) K500E probably damaging Het
Tmem131l G T 3: 83,839,046 (GRCm39) R635S probably benign Het
Tmem68 T C 4: 3,569,594 (GRCm39) E32G possibly damaging Het
Vmn2r101 T A 17: 19,809,077 (GRCm39) probably null Het
Zfp780b A G 7: 27,663,055 (GRCm39) I500T probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79,296,234 (GRCm39) unclassified probably benign
IGL00940:Zfyve26 APN 12 79,327,674 (GRCm39) missense probably benign
IGL01148:Zfyve26 APN 12 79,307,644 (GRCm39) missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79,298,957 (GRCm39) splice site probably null
IGL01472:Zfyve26 APN 12 79,323,117 (GRCm39) missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79,291,147 (GRCm39) missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79,334,625 (GRCm39) missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79,308,348 (GRCm39) splice site probably null
IGL01689:Zfyve26 APN 12 79,330,827 (GRCm39) missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79,334,218 (GRCm39) missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79,291,174 (GRCm39) missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79,323,169 (GRCm39) missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79,315,621 (GRCm39) missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79,326,854 (GRCm39) missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79,285,794 (GRCm39) missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79,310,644 (GRCm39) missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79,308,565 (GRCm39) missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79,342,338 (GRCm39) missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79,330,846 (GRCm39) nonsense probably null
challenge UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
fourteener UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
IGL02799:Zfyve26 UTSW 12 79,320,084 (GRCm39) missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79,323,055 (GRCm39) missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79,291,258 (GRCm39) missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79,292,996 (GRCm39) missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79,315,502 (GRCm39) missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79,312,576 (GRCm39) splice site probably benign
R0738:Zfyve26 UTSW 12 79,342,308 (GRCm39) missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79,320,372 (GRCm39) missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79,318,901 (GRCm39) missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79,310,723 (GRCm39) missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79,321,694 (GRCm39) missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79,329,591 (GRCm39) missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79,298,937 (GRCm39) missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79,298,925 (GRCm39) missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79,334,535 (GRCm39) missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79,285,718 (GRCm39) missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79,325,237 (GRCm39) missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79,315,823 (GRCm39) missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79,333,032 (GRCm39) missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79,311,125 (GRCm39) missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79,286,744 (GRCm39) nonsense probably null
R1982:Zfyve26 UTSW 12 79,302,017 (GRCm39) missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79,330,806 (GRCm39) splice site probably null
R2071:Zfyve26 UTSW 12 79,334,220 (GRCm39) missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79,292,826 (GRCm39) missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79,292,861 (GRCm39) missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79,321,814 (GRCm39) missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79,330,890 (GRCm39) missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79,329,573 (GRCm39) splice site probably null
R3084:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R4626:Zfyve26 UTSW 12 79,315,844 (GRCm39) missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79,291,170 (GRCm39) missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79,296,469 (GRCm39) splice site probably null
R4926:Zfyve26 UTSW 12 79,321,785 (GRCm39) missense probably benign
R4990:Zfyve26 UTSW 12 79,334,607 (GRCm39) missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79,327,159 (GRCm39) nonsense probably null
R5029:Zfyve26 UTSW 12 79,333,097 (GRCm39) missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79,302,135 (GRCm39) missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79,326,832 (GRCm39) nonsense probably null
R5252:Zfyve26 UTSW 12 79,315,756 (GRCm39) missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79,317,624 (GRCm39) missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79,293,295 (GRCm39) missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79,286,698 (GRCm39) missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79,320,147 (GRCm39) missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79,311,131 (GRCm39) missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79,334,511 (GRCm39) missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79,313,311 (GRCm39) missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79,340,628 (GRCm39) missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79,315,501 (GRCm39) missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79,296,373 (GRCm39) missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79,286,776 (GRCm39) missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79,285,109 (GRCm39) missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79,313,223 (GRCm39) missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79,330,926 (GRCm39) missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79,325,888 (GRCm39) missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79,327,179 (GRCm39) missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79,315,182 (GRCm39) missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79,292,945 (GRCm39) missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79,325,146 (GRCm39) splice site probably null
R7299:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79,297,942 (GRCm39) missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79,286,828 (GRCm39) missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79,334,581 (GRCm39) missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79,315,450 (GRCm39) missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79,337,731 (GRCm39) missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79,315,409 (GRCm39) missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79,327,129 (GRCm39) critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79,302,098 (GRCm39) missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79,315,331 (GRCm39) missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79,327,610 (GRCm39) missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79,307,605 (GRCm39) missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
R8500:Zfyve26 UTSW 12 79,334,454 (GRCm39) missense probably damaging 0.99
R8686:Zfyve26 UTSW 12 79,334,227 (GRCm39) missense probably benign
R8758:Zfyve26 UTSW 12 79,311,083 (GRCm39) critical splice donor site probably benign
R8826:Zfyve26 UTSW 12 79,285,742 (GRCm39) missense probably benign 0.05
R8877:Zfyve26 UTSW 12 79,334,152 (GRCm39) missense probably benign 0.05
R9067:Zfyve26 UTSW 12 79,318,915 (GRCm39) missense probably damaging 0.99
R9195:Zfyve26 UTSW 12 79,311,168 (GRCm39) missense probably benign 0.12
R9269:Zfyve26 UTSW 12 79,323,076 (GRCm39) missense possibly damaging 0.73
R9273:Zfyve26 UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
R9340:Zfyve26 UTSW 12 79,321,680 (GRCm39) nonsense probably null
R9348:Zfyve26 UTSW 12 79,315,231 (GRCm39) missense possibly damaging 0.81
R9482:Zfyve26 UTSW 12 79,291,239 (GRCm39) missense probably damaging 1.00
R9536:Zfyve26 UTSW 12 79,298,046 (GRCm39) missense probably benign 0.32
R9653:Zfyve26 UTSW 12 79,334,418 (GRCm39) missense probably benign
R9676:Zfyve26 UTSW 12 79,330,959 (GRCm39) missense probably benign 0.01
R9797:Zfyve26 UTSW 12 79,293,006 (GRCm39) missense probably damaging 0.98
RF010:Zfyve26 UTSW 12 79,302,112 (GRCm39) missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79,285,779 (GRCm39) missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79,315,307 (GRCm39) missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79,334,149 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGTGGGGAATTTCACAG -3'
(R):5'- CCCTTCCATGGACATACTCTAG -3'

Sequencing Primer
(F):5'- GGGAATTTCACAGAGGAATACTACC -3'
(R):5'- TCCATGGACATACTCTAGATGCG -3'
Posted On 2015-02-05