Incidental Mutation 'R3086:Tiam2'
ID265652
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3421582 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 500 (K500E)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]
Predicted Effect probably damaging
Transcript: ENSMUST00000072156
AA Change: K500E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: K500E

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169838
AA Change: K500E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: K500E

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226905
Meta Mutation Damage Score 0.1986 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3518585 missense probably damaging 0.99
R8260:Tiam2 UTSW 17 3518319 missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3518262 missense probably benign 0.05
R8530:Tiam2 UTSW 17 3450812 missense probably benign 0.03
R8692:Tiam2 UTSW 17 3428807 missense probably damaging 1.00
R8902:Tiam2 UTSW 17 3477196 missense probably benign 0.00
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGACATCTTCCTTACTGTG -3'
(R):5'- AGGAAGAACAAGCCTCCTGC -3'

Sequencing Primer
(F):5'- AGACATCTTCCTTACTGTGGTCAGG -3'
(R):5'- GCCTCCTGCTAGCATGAC -3'
Posted On2015-02-05