Incidental Mutation 'R2971:Olfr1040'
ID265659
Institutional Source Beutler Lab
Gene Symbol Olfr1040
Ensembl Gene ENSMUSG00000075203
Gene Nameolfactory receptor 1040
SynonymsMOR185-12, GA_x6K02T2Q125-47615732-47614791
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86145791-86146732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86146564 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000097493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099909]
Predicted Effect probably damaging
Transcript: ENSMUST00000099909
AA Change: T57A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097493
Gene: ENSMUSG00000075203
AA Change: T57A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 5.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215884
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Olfr1040
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1040 APN 2 86146611 missense probably benign 0.22
IGL01106:Olfr1040 APN 2 86146216 missense probably benign 0.09
IGL02193:Olfr1040 APN 2 86146715 missense probably benign 0.00
IGL02730:Olfr1040 APN 2 86146099 missense probably benign 0.05
IGL03032:Olfr1040 APN 2 86146699 missense probably damaging 1.00
IGL03165:Olfr1040 APN 2 86146068 missense possibly damaging 0.91
R0388:Olfr1040 UTSW 2 86146630 missense probably damaging 1.00
R4168:Olfr1040 UTSW 2 86146179 missense probably benign 0.03
R4532:Olfr1040 UTSW 2 86145930 missense possibly damaging 0.77
R5024:Olfr1040 UTSW 2 86146533 missense probably damaging 1.00
R5175:Olfr1040 UTSW 2 86145957 missense probably damaging 1.00
R5574:Olfr1040 UTSW 2 86146191 missense probably damaging 1.00
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6137:Olfr1040 UTSW 2 86145969 missense probably benign
R6945:Olfr1040 UTSW 2 86146084 missense probably damaging 1.00
R6980:Olfr1040 UTSW 2 86146337 nonsense probably null
R7065:Olfr1040 UTSW 2 86146001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATTACTGACAGCAAGTAC -3'
(R):5'- CACTTGGAATGAGTGTGGTGAC -3'

Sequencing Primer
(F):5'- GCCATTACTGACAGCAAGTACATTTC -3'
(R):5'- GTGGTAAACACTTGTACAGTCTATGG -3'
Posted On2015-02-05