Incidental Mutation 'R2971:Ctnnbl1'
ID265662
Institutional Source Beutler Lab
Gene Symbol Ctnnbl1
Ensembl Gene ENSMUSG00000027649
Gene Namecatenin, beta like 1
SynonymsP14L, FLJ21108, NYD-SP19, 5730471K09Rik
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157737401-157891614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 157871186 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 464 (H464Y)
Ref Sequence ENSEMBL: ENSMUSP00000029178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029178]
Predicted Effect probably benign
Transcript: ENSMUST00000029178
AA Change: H464Y

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649
AA Change: H464Y

DomainStartEndE-ValueType
DUF1716 52 162 3.97e-61 SMART
Meta Mutation Damage Score 0.1043 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Ctnnbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ctnnbl1 APN 2 157819541 missense possibly damaging 0.80
IGL01374:Ctnnbl1 APN 2 157836693 critical splice donor site probably null
IGL01504:Ctnnbl1 APN 2 157818116 splice site probably benign
IGL01622:Ctnnbl1 APN 2 157819548 missense probably damaging 1.00
IGL01623:Ctnnbl1 APN 2 157819548 missense probably damaging 1.00
IGL02146:Ctnnbl1 APN 2 157819494 missense probably damaging 1.00
IGL02550:Ctnnbl1 APN 2 157884135 missense probably benign 0.00
IGL03104:Ctnnbl1 APN 2 157890965 missense probably damaging 0.99
IGL03164:Ctnnbl1 APN 2 157817761 missense probably benign
R0482:Ctnnbl1 UTSW 2 157871190 critical splice donor site probably null
R0826:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0827:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0862:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0863:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0864:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R1466:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R1533:Ctnnbl1 UTSW 2 157836643 missense probably benign
R3522:Ctnnbl1 UTSW 2 157871193 splice site probably null
R4296:Ctnnbl1 UTSW 2 157819570 synonymous probably null
R4982:Ctnnbl1 UTSW 2 157836553 missense probably benign 0.01
R5396:Ctnnbl1 UTSW 2 157817832 splice site probably null
R5857:Ctnnbl1 UTSW 2 157789098 missense probably damaging 1.00
R7710:Ctnnbl1 UTSW 2 157774571 missense probably benign 0.00
R7769:Ctnnbl1 UTSW 2 157737470 start gained probably benign
R8134:Ctnnbl1 UTSW 2 157809471 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GATGCTCATCCCCATGTCAG -3'
(R):5'- AACCACTTGAAGGGTAGTTACAC -3'

Sequencing Primer
(F):5'- TCATCCCCATGTCAGAAGTGG -3'
(R):5'- TGACCTCTGTGGAAATGCAC -3'
Posted On2015-02-05