Incidental Mutation 'R2971:Ube2v1'
ID265663
Institutional Source Beutler Lab
Gene Symbol Ube2v1
Ensembl Gene ENSMUSG00000078923
Gene Nameubiquitin-conjugating enzyme E2 variant 1
SynonymsD7Bwg1382e, CROC1, 0610011J09Rik
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167607638-167632095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167610336 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 89 (N89D)
Ref Sequence ENSEMBL: ENSMUSP00000104830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060645] [ENSMUST00000109207] [ENSMUST00000125544] [ENSMUST00000140216] [ENSMUST00000151365]
Predicted Effect probably benign
Transcript: ENSMUST00000060645
SMART Domains Protein: ENSMUSP00000053109
Gene: ENSMUSG00000078923

DomainStartEndE-ValueType
PDB:2C2V|L 7 105 7e-59 PDB
SCOP:d1jatb_ 10 103 4e-31 SMART
Blast:UBCc 15 105 1e-54 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109207
AA Change: N89D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104830
Gene: ENSMUSG00000078923
AA Change: N89D

DomainStartEndE-ValueType
UBCc 15 147 1.53e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125544
AA Change: N313D

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118416
Gene: ENSMUSG00000089739
AA Change: N313D

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
UBCc 239 371 1.53e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130284
Predicted Effect probably benign
Transcript: ENSMUST00000140216
AA Change: N116D

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116578
Gene: ENSMUSG00000078923
AA Change: N116D

DomainStartEndE-ValueType
UBCc 42 125 6.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144628
Predicted Effect possibly damaging
Transcript: ENSMUST00000151365
AA Change: N115D

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114764
Gene: ENSMUSG00000078923
AA Change: N115D

DomainStartEndE-ValueType
UBCc 41 173 1.53e-14 SMART
Meta Mutation Damage Score 0.7381 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Ube2v1
AlleleSourceChrCoordTypePredicted EffectPPH Score
ANU74:Ube2v1 UTSW 2 167610344 missense probably damaging 1.00
R1219:Ube2v1 UTSW 2 167617911 missense probably benign 0.20
R2862:Ube2v1 UTSW 2 167617965 missense probably damaging 1.00
R4666:Ube2v1 UTSW 2 167610377 missense probably damaging 1.00
R4894:Ube2v1 UTSW 2 167610360 missense probably damaging 0.99
R6150:Ube2v1 UTSW 2 167617954 nonsense probably null
R7260:Ube2v1 UTSW 2 167629194 missense probably benign 0.02
R7356:Ube2v1 UTSW 2 167609195 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCATGGACACTGAACACTC -3'
(R):5'- GTCGGACTCATTGACACTTAACC -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACTAGGCTG -3'
(R):5'- GTGCTTCCGTCTCTGAGGC -3'
Posted On2015-02-05