Incidental Mutation 'R2971:Zfp697'
ID265666
Institutional Source Beutler Lab
Gene Symbol Zfp697
Ensembl Gene ENSMUSG00000050064
Gene Namezinc finger protein 697
Synonyms
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2971 (G1)
Quality Score119
Status Validated
Chromosome3
Chromosomal Location98382461-98753812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98428301 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 461 (Y461H)
Ref Sequence ENSEMBL: ENSMUSP00000136417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056096] [ENSMUST00000178372]
Predicted Effect probably damaging
Transcript: ENSMUST00000056096
AA Change: Y461H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056979
Gene: ENSMUSG00000050064
AA Change: Y461H

DomainStartEndE-ValueType
low complexity region 83 96 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
ZnF_C2H2 202 224 3.72e0 SMART
low complexity region 245 268 N/A INTRINSIC
ZnF_C2H2 280 302 3.63e-3 SMART
ZnF_C2H2 308 330 1.76e-1 SMART
ZnF_C2H2 336 358 6.78e-3 SMART
ZnF_C2H2 377 399 2.57e-3 SMART
ZnF_C2H2 405 427 2.09e-3 SMART
ZnF_C2H2 433 455 7.26e-3 SMART
ZnF_C2H2 461 483 6.42e-4 SMART
ZnF_C2H2 489 511 2.91e-2 SMART
ZnF_C2H2 517 539 9.73e-4 SMART
ZnF_C2H2 545 567 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178372
AA Change: Y461H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136417
Gene: ENSMUSG00000050064
AA Change: Y461H

DomainStartEndE-ValueType
low complexity region 83 96 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
ZnF_C2H2 202 224 3.72e0 SMART
low complexity region 245 268 N/A INTRINSIC
ZnF_C2H2 280 302 3.63e-3 SMART
ZnF_C2H2 308 330 1.76e-1 SMART
ZnF_C2H2 336 358 6.78e-3 SMART
ZnF_C2H2 377 399 2.57e-3 SMART
ZnF_C2H2 405 427 2.09e-3 SMART
ZnF_C2H2 433 455 7.26e-3 SMART
ZnF_C2H2 461 483 6.42e-4 SMART
ZnF_C2H2 489 511 2.91e-2 SMART
ZnF_C2H2 517 539 9.73e-4 SMART
ZnF_C2H2 545 567 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.2158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Other mutations in Zfp697
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Zfp697 APN 3 98427530 missense probably damaging 0.99
IGL02313:Zfp697 APN 3 98425450 missense probably benign 0.01
IGL03055:Zfp697 UTSW 3 98425494 missense possibly damaging 0.51
R0724:Zfp697 UTSW 3 98428166 missense probably damaging 1.00
R2165:Zfp697 UTSW 3 98428014 missense unknown
R5749:Zfp697 UTSW 3 98425464 missense probably benign
R5954:Zfp697 UTSW 3 98428593 missense probably damaging 0.99
R6253:Zfp697 UTSW 3 98427539 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCGCATCTGGCCAATCAC -3'
(R):5'- CGCACTCGAGACATGTGTAGG -3'

Sequencing Primer
(F):5'- TGGCCAATCACCAGCGC -3'
(R):5'- ACTCGAGACATGTGTAGGGCTTC -3'
Posted On2015-02-05