Incidental Mutation 'R0142:Nek10'
ID26567
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0142 (G1)
Quality Score118
Status Validated (trace)
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14861560 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 539 (R539C)
Ref Sequence ENSEMBL: ENSMUSP00000108250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063220
Predicted Effect possibly damaging
Transcript: ENSMUST00000112630
AA Change: R539C

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: R539C

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112631
AA Change: R539C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: R539C

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134866
Predicted Effect possibly damaging
Transcript: ENSMUST00000224491
AA Change: R539C

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 synonymous probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
Z1177:Nek10 UTSW 14 14853948 missense probably benign 0.00
Z1177:Nek10 UTSW 14 15001157 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTTCTACACCTGCCCAGGGAAAG -3'
(R):5'- GCATCCAAGGCCCTGCTATAAACTC -3'

Sequencing Primer
(F):5'- AAAGCCTGTTGAGTCCTGC -3'
(R):5'- ACCAATGTCCAGTATTTCATACCG -3'
Posted On2013-04-17