Incidental Mutation 'R2971:Skint1'
ID265670
Institutional Source Beutler Lab
Gene Symbol Skint1
Ensembl Gene ENSMUSG00000089773
Gene Nameselection and upkeep of intraepithelial T cells 1
Synonyms
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112006269-112029538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112021330 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 153 (P153H)
Ref Sequence ENSEMBL: ENSMUSP00000124545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117379] [ENSMUST00000161389] [ENSMUST00000162158] [ENSMUST00000162885]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117379
AA Change: P153H

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124545
Gene: ENSMUSG00000089773
AA Change: P153H

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 2.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161389
AA Change: P153H

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125313
Gene: ENSMUSG00000089773
AA Change: P153H

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 3.1e-6 PFAM
transmembrane domain 248 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162158
AA Change: P153H

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124737
Gene: ENSMUSG00000089773
AA Change: P153H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGv 44 125 1.88e-8 SMART
transmembrane domain 247 269 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162885
SMART Domains Protein: ENSMUSP00000125625
Gene: ENSMUSG00000089773

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation allele exhibit impaired T cell differentiation with reduced Vgamma5+Vdelta1+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Skint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Skint1 APN 4 112021580 critical splice donor site probably null
IGL01890:Skint1 APN 4 112010681 missense probably damaging 1.00
IGL02020:Skint1 APN 4 112025527 missense probably benign 0.08
IGL02045:Skint1 APN 4 112025530 missense possibly damaging 0.80
R0421:Skint1 UTSW 4 112019014 missense possibly damaging 0.74
R0544:Skint1 UTSW 4 112021365 missense probably damaging 1.00
R0617:Skint1 UTSW 4 112029399 splice site probably benign
R0881:Skint1 UTSW 4 112028857 missense probably benign 0.04
R0973:Skint1 UTSW 4 112028215 splice site probably benign
R1036:Skint1 UTSW 4 112019296 missense possibly damaging 0.71
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R2029:Skint1 UTSW 4 112021456 unclassified probably null
R2063:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2064:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2065:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2066:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2067:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2372:Skint1 UTSW 4 112019151 missense probably damaging 1.00
R2518:Skint1 UTSW 4 112025481 missense probably benign 0.25
R4656:Skint1 UTSW 4 112021477 missense probably damaging 1.00
R4993:Skint1 UTSW 4 112028333 critical splice donor site probably null
R5083:Skint1 UTSW 4 112029433 missense probably benign 0.01
R5450:Skint1 UTSW 4 112025532 missense probably benign 0.00
R5583:Skint1 UTSW 4 112019056 missense probably damaging 1.00
R5645:Skint1 UTSW 4 112025502 missense probably benign 0.41
R5877:Skint1 UTSW 4 112021523 nonsense probably null
R5950:Skint1 UTSW 4 112019335 missense probably benign
R5974:Skint1 UTSW 4 112019319 missense probably benign 0.02
R6216:Skint1 UTSW 4 112021482 missense probably benign 0.00
R6494:Skint1 UTSW 4 112010712 missense probably benign 0.06
R7348:Skint1 UTSW 4 112021573 missense probably damaging 1.00
R7752:Skint1 UTSW 4 112019202 missense probably damaging 1.00
R7901:Skint1 UTSW 4 112019202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCCAGACTATGACTTTCTATCAG -3'
(R):5'- GACTTTCTGGAAGAAGCTTTCAC -3'

Sequencing Primer
(F):5'- GCAATTAGAGCCCTTACCTC -3'
(R):5'- CTGGAAGAAGCTTTCACTAATGAG -3'
Posted On2015-02-05