Incidental Mutation 'R2971:Man1c1'
ID265671
Institutional Source Beutler Lab
Gene Symbol Man1c1
Ensembl Gene ENSMUSG00000037306
Gene Namemannosidase, alpha, class 1C, member 1
Synonyms
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R2971 (G1)
Quality Score181
Status Validated
Chromosome4
Chromosomal Location134561690-134704290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 134703438 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 11 (P11R)
Ref Sequence ENSEMBL: ENSMUSP00000050979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038628] [ENSMUST00000054096]
Predicted Effect probably damaging
Transcript: ENSMUST00000038628
AA Change: P11R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037949
Gene: ENSMUSG00000037306
AA Change: P11R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Pfam:Glyco_hydro_47 176 612 9.9e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054096
AA Change: P11R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050979
Gene: ENSMUSG00000037306
AA Change: P11R

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Pfam:Glyco_hydro_47 176 612 1.1e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176606
Meta Mutation Damage Score 0.3035 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Man1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Man1c1 APN 4 134564532 missense probably damaging 1.00
IGL02237:Man1c1 APN 4 134584298 critical splice donor site probably null
R0201:Man1c1 UTSW 4 134640398 splice site probably null
R0390:Man1c1 UTSW 4 134578315 missense probably damaging 1.00
R0526:Man1c1 UTSW 4 134569068 nonsense probably null
R1108:Man1c1 UTSW 4 134564613 missense probably damaging 1.00
R1518:Man1c1 UTSW 4 134580789 missense probably benign 0.01
R1756:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1866:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1914:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1915:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2171:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2172:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2937:Man1c1 UTSW 4 134702952 missense possibly damaging 0.72
R2938:Man1c1 UTSW 4 134702952 missense possibly damaging 0.72
R3806:Man1c1 UTSW 4 134703351 missense probably damaging 1.00
R3977:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R3979:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4037:Man1c1 UTSW 4 134593339 missense probably damaging 1.00
R4065:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4066:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4067:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4209:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4210:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4211:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4290:Man1c1 UTSW 4 134563785 missense probably damaging 1.00
R4431:Man1c1 UTSW 4 134703018 missense probably damaging 1.00
R4694:Man1c1 UTSW 4 134703189 missense probably benign 0.27
R4766:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R5226:Man1c1 UTSW 4 134578369 missense probably damaging 1.00
R5637:Man1c1 UTSW 4 134591424 missense probably damaging 1.00
R5677:Man1c1 UTSW 4 134569060 missense probably damaging 1.00
R5939:Man1c1 UTSW 4 134565836 missense probably damaging 0.99
R7251:Man1c1 UTSW 4 134580836 missense probably damaging 1.00
R7577:Man1c1 UTSW 4 134564503 critical splice donor site probably null
X0019:Man1c1 UTSW 4 134576007 missense probably damaging 1.00
X0062:Man1c1 UTSW 4 134703372 missense possibly damaging 0.74
X0063:Man1c1 UTSW 4 134575977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGAACCGGACGCTCTC -3'
(R):5'- GCTCCAAACTCCCTGAACTTCG -3'

Sequencing Primer
(F):5'- TCCTGCTCTGACACCGAGTG -3'
(R):5'- TGAACTTCGGGCGGGTC -3'
Posted On2015-02-05