Incidental Mutation 'R2971:Tmem201'
ID265672
Institutional Source Beutler Lab
Gene Symbol Tmem201
Ensembl Gene ENSMUSG00000044700
Gene Nametransmembrane protein 201
SynonymsSamp1, D4Ertd429e
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149715375-149738044 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 149722445 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054459] [ENSMUST00000103208] [ENSMUST00000105687]
Predicted Effect probably benign
Transcript: ENSMUST00000054459
SMART Domains Protein: ENSMUSP00000050481
Gene: ENSMUSG00000044700

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.6e-43 PFAM
Pfam:DUF2448 191 392 4.4e-102 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103208
SMART Domains Protein: ENSMUSP00000099497
Gene: ENSMUSG00000044700

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 1.1e-43 PFAM
Pfam:DUF2448 191 392 2.1e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105687
SMART Domains Protein: ENSMUSP00000101312
Gene: ENSMUSG00000044700

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.4e-39 PFAM
Pfam:DUF2448 191 389 3.1e-96 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139923
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Tmem201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Tmem201 APN 4 149719588 splice site probably benign
R0508:Tmem201 UTSW 4 149731886 missense probably damaging 1.00
R0717:Tmem201 UTSW 4 149718810 missense probably damaging 1.00
R1660:Tmem201 UTSW 4 149719575 missense probably damaging 1.00
R2138:Tmem201 UTSW 4 149718080 missense probably damaging 1.00
R4430:Tmem201 UTSW 4 149731139 missense probably benign 0.03
R4704:Tmem201 UTSW 4 149727317 missense possibly damaging 0.77
R4876:Tmem201 UTSW 4 149722270 missense probably damaging 1.00
R4966:Tmem201 UTSW 4 149718687 missense probably benign
R4991:Tmem201 UTSW 4 149728155 missense possibly damaging 0.95
R5518:Tmem201 UTSW 4 149718077 missense probably benign
R5818:Tmem201 UTSW 4 149727392 missense probably benign 0.33
R7399:Tmem201 UTSW 4 149731097 missense possibly damaging 0.95
R8142:Tmem201 UTSW 4 149718657 missense probably benign
R8170:Tmem201 UTSW 4 149718720 missense probably benign 0.29
X0064:Tmem201 UTSW 4 149718071 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCAGAGGAGGTATGGTTCCCAG -3'
(R):5'- ACCTGCTCCTAATCAGTGGAC -3'

Sequencing Primer
(F):5'- TATGGTTCCCAGCGAGAGG -3'
(R):5'- AATCAGTGGACAGTTGCCTC -3'
Posted On2015-02-05