Incidental Mutation 'R2971:Slc15a4'
ID265674
Institutional Source Beutler Lab
Gene Symbol Slc15a4
Ensembl Gene ENSMUSG00000029416
Gene Namesolute carrier family 15, member 4
SynonymsPHT1, C130069N12Rik, PTR4
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2971 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location127595664-127632897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127604536 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031367] [ENSMUST00000152727] [ENSMUST00000152727] [ENSMUST00000153832] [ENSMUST00000155321]
Predicted Effect probably null
Transcript: ENSMUST00000031367
SMART Domains Protein: ENSMUSP00000031367
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Pfam:MFS_1 33 505 7.8e-13 PFAM
Pfam:PTR2 96 519 3.6e-127 PFAM
transmembrane domain 533 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124569
SMART Domains Protein: ENSMUSP00000121595
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTR2 49 242 8.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144603
SMART Domains Protein: ENSMUSP00000116420
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 127 2.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153832
SMART Domains Protein: ENSMUSP00000123116
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Pfam:PTR2 96 292 5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155321
SMART Domains Protein: ENSMUSP00000117258
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 105 1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200212
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation display abrogation of both Toll-like receptor (TLR)-induced type I IFN and proinflammatory cytokine production by plasmacytoid dendritic cells. Conventional dendritic cells respond normally to TLR ligands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Slc15a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc15a4 APN 5 127601960 missense probably benign 0.13
IGL01543:Slc15a4 APN 5 127603766 missense probably benign 0.12
IGL01805:Slc15a4 APN 5 127608836 missense possibly damaging 0.91
IGL02958:Slc15a4 APN 5 127604665 missense possibly damaging 0.93
IGL03367:Slc15a4 APN 5 127601941 missense probably damaging 1.00
feeble UTSW 5 127608770 unclassified probably benign
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0838:Slc15a4 UTSW 5 127617003 missense possibly damaging 0.53
R1544:Slc15a4 UTSW 5 127603768 missense probably benign 0.01
R1662:Slc15a4 UTSW 5 127608979 missense probably damaging 1.00
R2504:Slc15a4 UTSW 5 127617239 missense possibly damaging 0.92
R2843:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2845:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2846:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2900:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3018:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3020:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3021:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3027:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3053:Slc15a4 UTSW 5 127596682 missense possibly damaging 0.83
R3155:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3432:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4356:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4357:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4359:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4448:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4449:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4450:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4514:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4544:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4546:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4952:Slc15a4 UTSW 5 127603837 missense probably damaging 1.00
R5278:Slc15a4 UTSW 5 127616969 missense probably damaging 0.99
R6393:Slc15a4 UTSW 5 127616886 missense probably benign 0.13
R6527:Slc15a4 UTSW 5 127596709 missense probably damaging 1.00
R7409:Slc15a4 UTSW 5 127604678 missense probably benign 0.04
R8223:Slc15a4 UTSW 5 127609016 missense possibly damaging 0.65
Z1177:Slc15a4 UTSW 5 127600524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTCTCAGAATCAGACATGG -3'
(R):5'- AGGCCTTGGAGTCTTTCAGC -3'

Sequencing Primer
(F):5'- GTCTCTTTGAGAAAAGCTTCCAGGC -3'
(R):5'- TCAGCAATCTTCTAAACACAGTCTG -3'
Posted On2015-02-05