Incidental Mutation 'R2971:Zfp282'
ID265675
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Namezinc finger protein 282
SynonymsHUB1
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2971 (G1)
Quality Score213
Status Validated
Chromosome6
Chromosomal Location47877204-47908485 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to T at 47897932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
Predicted Effect probably null
Transcript: ENSMUST00000061890
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47890120 missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47880277 missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47897914 missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47904797 small insertion probably benign
FR4589:Zfp282 UTSW 6 47904791 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904790 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904799 small insertion probably benign
FR4976:Zfp282 UTSW 6 47904790 small insertion probably benign
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47892932 missense probably benign 0.34
R0415:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
R0415:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
R0607:Zfp282 UTSW 6 47880369 missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47880384 missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47904599 missense probably benign 0.00
R1401:Zfp282 UTSW 6 47890174 nonsense probably null
R1572:Zfp282 UTSW 6 47892867 missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47897787 intron probably null
R4064:Zfp282 UTSW 6 47880094 missense probably damaging 0.99
R4478:Zfp282 UTSW 6 47890696 nonsense probably null
R4530:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R4532:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R5068:Zfp282 UTSW 6 47877703 missense probably benign 0.01
R5261:Zfp282 UTSW 6 47897890 missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47905327 missense probably benign
R5551:Zfp282 UTSW 6 47890645 missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47880168 missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47880385 missense probably damaging 1.00
R7535:Zfp282 UTSW 6 47904944 missense probably benign 0.03
R8098:Zfp282 UTSW 6 47890718 missense probably benign 0.00
R8158:Zfp282 UTSW 6 47890692 missense possibly damaging 0.61
R8304:Zfp282 UTSW 6 47904788 small deletion probably benign
S24628:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
S24628:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
Z1177:Zfp282 UTSW 6 47890637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACACGGACTGGTGGGATTCC -3'
(R):5'- CTTGCTCTTTGACACACAAATACAC -3'

Sequencing Primer
(F):5'- GGTGGGATTCCTCCTTCTCTAACATG -3'
(R):5'- ATTCACTCTGAGGGACTGGAG -3'
Posted On2015-02-05