Incidental Mutation 'R2971:Aebp2'
ID265676
Institutional Source Beutler Lab
Gene Symbol Aebp2
Ensembl Gene ENSMUSG00000030232
Gene NameAE binding protein 2
SynonymsB230313N05Rik
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location140622663-140678472 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 140633898 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032359] [ENSMUST00000087614] [ENSMUST00000095350] [ENSMUST00000160836] [ENSMUST00000160836] [ENSMUST00000161335] [ENSMUST00000161335]
Predicted Effect probably null
Transcript: ENSMUST00000032359
SMART Domains Protein: ENSMUSP00000032359
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068583
SMART Domains Protein: ENSMUSP00000064302
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 53 78 1.26e-2 SMART
ZnF_C2H2 87 114 5.92e0 SMART
ZnF_C2H2 120 144 2.2e-2 SMART
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087614
SMART Domains Protein: ENSMUSP00000084896
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
low complexity region 1 71 N/A INTRINSIC
low complexity region 81 124 N/A INTRINSIC
low complexity region 128 199 N/A INTRINSIC
ZnF_C2H2 254 279 1.26e-2 SMART
ZnF_C2H2 288 315 5.92e0 SMART
ZnF_C2H2 321 345 2.2e-2 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095350
SMART Domains Protein: ENSMUSP00000092993
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
ZnF_C2H2 77 102 1.26e-2 SMART
ZnF_C2H2 111 138 5.92e0 SMART
ZnF_C2H2 144 168 2.2e-2 SMART
low complexity region 194 210 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160836
SMART Domains Protein: ENSMUSP00000124148
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160836
SMART Domains Protein: ENSMUSP00000124148
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161335
SMART Domains Protein: ENSMUSP00000125479
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161335
SMART Domains Protein: ENSMUSP00000125479
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 32 57 1.26e-2 SMART
ZnF_C2H2 66 93 5.92e0 SMART
ZnF_C2H2 99 123 2.2e-2 SMART
low complexity region 149 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162903
SMART Domains Protein: ENSMUSP00000123897
Gene: ENSMUSG00000030232

DomainStartEndE-ValueType
ZnF_C2H2 2 26 2.2e-2 SMART
low complexity region 52 68 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204724
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene show complete embryonic lethality. Heterozygous mutant mice show aganglionic megacolon, hypopigmentation of the tail tip and hind toes, and a decreased startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Aebp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Aebp2 APN 6 140642254 missense probably benign 0.29
IGL01935:Aebp2 APN 6 140637657 unclassified probably benign
IGL02149:Aebp2 APN 6 140642284 missense probably benign 0.06
PIT4453001:Aebp2 UTSW 6 140637686 nonsense probably null
R0030:Aebp2 UTSW 6 140637747 missense probably damaging 0.99
R0091:Aebp2 UTSW 6 140644074 critical splice donor site probably null
R0744:Aebp2 UTSW 6 140642364 splice site probably null
R1603:Aebp2 UTSW 6 140642253 missense probably damaging 0.98
R1990:Aebp2 UTSW 6 140633738 missense probably damaging 1.00
R2073:Aebp2 UTSW 6 140633694 missense probably benign 0.41
R2075:Aebp2 UTSW 6 140633694 missense probably benign 0.41
R3805:Aebp2 UTSW 6 140643949 frame shift probably null
R3911:Aebp2 UTSW 6 140647981 missense probably damaging 1.00
R3921:Aebp2 UTSW 6 140633735 missense probably damaging 1.00
R4020:Aebp2 UTSW 6 140642295 missense probably damaging 1.00
R4374:Aebp2 UTSW 6 140654258 utr 3 prime probably benign
R4856:Aebp2 UTSW 6 140644073 critical splice donor site probably null
R5022:Aebp2 UTSW 6 140637730 missense possibly damaging 0.90
R5140:Aebp2 UTSW 6 140633806 nonsense probably null
R5761:Aebp2 UTSW 6 140624217 unclassified probably benign
R6983:Aebp2 UTSW 6 140637663 missense possibly damaging 0.91
R7168:Aebp2 UTSW 6 140633700 missense probably damaging 0.98
R7259:Aebp2 UTSW 6 140633768 missense probably benign 0.03
R7463:Aebp2 UTSW 6 140637726 nonsense probably null
R7556:Aebp2 UTSW 6 140677411 missense probably benign 0.07
R7654:Aebp2 UTSW 6 140653748 splice site probably null
R7745:Aebp2 UTSW 6 140623858 missense unknown
R8258:Aebp2 UTSW 6 140637727 missense possibly damaging 0.82
R8259:Aebp2 UTSW 6 140637727 missense possibly damaging 0.82
Z1177:Aebp2 UTSW 6 140624094 missense unknown
Predicted Primers PCR Primer
(F):5'- AATTTCCAGTGGACGCTCAACC -3'
(R):5'- ACCTTGGGAGTCACTGTGTC -3'

Sequencing Primer
(F):5'- ACCCCGGCCATGATGAATG -3'
(R):5'- ACGTCTACTACAGCTTTAAAGGG -3'
Posted On2015-02-05