Incidental Mutation 'R2971:Plscr2'
ID265681
Institutional Source Beutler Lab
Gene Symbol Plscr2
Ensembl Gene ENSMUSG00000032372
Gene Namephospholipid scramblase 2
SynonymsPL scramblase
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location92275602-92297752 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 92290671 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 128 (E128*)
Ref Sequence ENSEMBL: ENSMUSP00000136481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034932] [ENSMUST00000113044] [ENSMUST00000180154]
Predicted Effect probably null
Transcript: ENSMUST00000034932
AA Change: E128*
SMART Domains Protein: ENSMUSP00000034932
Gene: ENSMUSG00000032372
AA Change: E128*

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
Pfam:Scramblase 84 305 5.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113044
SMART Domains Protein: ENSMUSP00000108667
Gene: ENSMUSG00000032372

DomainStartEndE-ValueType
Pfam:Scramblase 1 170 5.8e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156772
Predicted Effect probably null
Transcript: ENSMUST00000180154
AA Change: E128*
SMART Domains Protein: ENSMUSP00000136481
Gene: ENSMUSG00000032372
AA Change: E128*

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
Pfam:Scramblase 84 305 5.1e-94 PFAM
Meta Mutation Damage Score 0.9713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Plscr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Plscr2 APN 9 92290632 splice site probably benign
IGL02496:Plscr2 APN 9 92289663 missense probably benign 0.12
R0401:Plscr2 UTSW 9 92282135 missense probably benign
R0620:Plscr2 UTSW 9 92287654 missense probably benign 0.10
R0879:Plscr2 UTSW 9 92287793 missense probably damaging 1.00
R1829:Plscr2 UTSW 9 92290755 missense probably damaging 1.00
R2022:Plscr2 UTSW 9 92295594 missense probably damaging 1.00
R2237:Plscr2 UTSW 9 92290824 missense probably damaging 1.00
R3552:Plscr2 UTSW 9 92290795 missense probably damaging 1.00
R3762:Plscr2 UTSW 9 92291080 missense probably damaging 1.00
R4214:Plscr2 UTSW 9 92287737 missense probably benign 0.09
R4528:Plscr2 UTSW 9 92289693 missense possibly damaging 0.87
R4679:Plscr2 UTSW 9 92287770 missense probably benign 0.13
R4708:Plscr2 UTSW 9 92291014 missense probably damaging 1.00
R4709:Plscr2 UTSW 9 92291014 missense probably damaging 1.00
R4831:Plscr2 UTSW 9 92291077 missense possibly damaging 0.89
R5244:Plscr2 UTSW 9 92291049 missense probably benign 0.33
R6102:Plscr2 UTSW 9 92287668 missense probably benign 0.32
R6298:Plscr2 UTSW 9 92290719 missense probably benign 0.05
R6893:Plscr2 UTSW 9 92290704 missense probably benign 0.05
R7320:Plscr2 UTSW 9 92291140 critical splice donor site probably null
R7876:Plscr2 UTSW 9 92287728 missense probably benign
R8220:Plscr2 UTSW 9 92295660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTTCCTGAGTCCAGATC -3'
(R):5'- AAGCTGCTATGGTTACTTCACAC -3'

Sequencing Primer
(F):5'- GAGTCCAGATCATCTCCGCACTG -3'
(R):5'- TCACACTGACCTCCTGGAG -3'
Posted On2015-02-05