Incidental Mutation 'R2971:Nme6'
ID265682
Institutional Source Beutler Lab
Gene Symbol Nme6
Ensembl Gene ENSMUSG00000032478
Gene NameNME/NM23 nucleoside diphosphate kinase 6
Synonymsnm23-M6, non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2971 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location109832749-109843116 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 109842091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035053] [ENSMUST00000197627] [ENSMUST00000199758] [ENSMUST00000200005] [ENSMUST00000200345] [ENSMUST00000200468]
Predicted Effect probably benign
Transcript: ENSMUST00000035053
SMART Domains Protein: ENSMUSP00000035053
Gene: ENSMUSG00000032478

DomainStartEndE-ValueType
NDK 11 152 5.9e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196797
Predicted Effect probably benign
Transcript: ENSMUST00000197627
SMART Domains Protein: ENSMUSP00000142778
Gene: ENSMUSG00000032478

DomainStartEndE-ValueType
Pfam:NDK 12 91 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199181
Predicted Effect probably benign
Transcript: ENSMUST00000199758
SMART Domains Protein: ENSMUSP00000143591
Gene: ENSMUSG00000032478

DomainStartEndE-ValueType
NDK 11 79 2.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200005
SMART Domains Protein: ENSMUSP00000142609
Gene: ENSMUSG00000032478

DomainStartEndE-ValueType
NDK 11 152 5.9e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200091
Predicted Effect probably benign
Transcript: ENSMUST00000200345
SMART Domains Protein: ENSMUSP00000142392
Gene: ENSMUSG00000032478

DomainStartEndE-ValueType
NDK 11 115 1.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200468
SMART Domains Protein: ENSMUSP00000143021
Gene: ENSMUSG00000032478

DomainStartEndE-ValueType
NDK 11 152 5.9e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside diphosphate (NDP) kinases (EC 2.7.4.6), such as NME6, are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates (Mehus et al., 1999 [PubMed 10453732]).[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Nme6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Nme6 APN 9 109841931 missense probably damaging 1.00
IGL03196:Nme6 APN 9 109841493 missense probably damaging 1.00
PIT4585001:Nme6 UTSW 9 109842036 missense possibly damaging 0.89
R1977:Nme6 UTSW 9 109835341 missense probably damaging 1.00
R4494:Nme6 UTSW 9 109842054 missense probably damaging 1.00
R5183:Nme6 UTSW 9 109841489 nonsense probably null
R7909:Nme6 UTSW 9 109841968 missense probably damaging 1.00
R8090:Nme6 UTSW 9 109841951 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGCCCTGCTCACAAACATG -3'
(R):5'- TATATAAAGGGAGCTCACAGGCC -3'

Sequencing Primer
(F):5'- TCACAAACATGTCCTAGACTAGGTAG -3'
(R):5'- AGCTCACAGGCCACATGG -3'
Posted On2015-02-05