Incidental Mutation 'R2971:Irgm1'
ID265683
Institutional Source Beutler Lab
Gene Symbol Irgm1
Ensembl Gene ENSMUSG00000046879
Gene Nameimmunity-related GTPase family M member 1
SynonymsIfi1, LRG-47, Irgm, Iigp3
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location48861968-48871683 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 48866590 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 131 (Y131*)
Ref Sequence ENSEMBL: ENSMUSP00000094870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049519] [ENSMUST00000097271]
Predicted Effect probably null
Transcript: ENSMUST00000049519
AA Change: Y147*
SMART Domains Protein: ENSMUSP00000050446
Gene: ENSMUSG00000046879
AA Change: Y147*

DomainStartEndE-ValueType
Pfam:IIGP 42 399 5.5e-169 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097271
AA Change: Y131*
SMART Domains Protein: ENSMUSP00000094870
Gene: ENSMUSG00000046879
AA Change: Y131*

DomainStartEndE-ValueType
Pfam:IIGP 26 288 2.5e-131 PFAM
Pfam:MMR_HSR1 62 175 2.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147151
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection and bacterial infection is impaired in homozygous mutant mice, whereas resistance to viral infection is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Irgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Irgm1 APN 11 48866005 nonsense probably null
IGL01821:Irgm1 APN 11 48866526 missense probably damaging 1.00
IGL02043:Irgm1 APN 11 48866815 missense probably damaging 0.98
IGL02252:Irgm1 APN 11 48866154 missense possibly damaging 0.92
IGL03153:Irgm1 APN 11 48866267 missense probably damaging 1.00
igraine UTSW 11 48866613 missense probably benign 0.33
R0487:Irgm1 UTSW 11 48866327 missense probably damaging 0.98
R1808:Irgm1 UTSW 11 48866432 missense probably damaging 0.99
R1809:Irgm1 UTSW 11 48866613 missense probably benign 0.33
R1878:Irgm1 UTSW 11 48866070 missense probably benign 0.07
R4492:Irgm1 UTSW 11 48866128 synonymous silent
R4962:Irgm1 UTSW 11 48866332 missense possibly damaging 0.93
R5186:Irgm1 UTSW 11 48866217 missense probably benign 0.00
R5794:Irgm1 UTSW 11 48866237 missense probably damaging 0.99
R6224:Irgm1 UTSW 11 48866886 missense probably benign 0.02
R6487:Irgm1 UTSW 11 48865950 missense probably benign 0.21
R6752:Irgm1 UTSW 11 48866463 missense probably damaging 1.00
R6766:Irgm1 UTSW 11 48866101 missense possibly damaging 0.80
R8005:Irgm1 UTSW 11 48866390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATATTCTGTAGGAGCCGGAC -3'
(R):5'- GCATCTTTGTGACTGGGGAC -3'

Sequencing Primer
(F):5'- TGTAGGAGCCGGACCTCTGATAG -3'
(R):5'- GACTCTGGCAATGGCATGTCATC -3'
Posted On2015-02-05