Incidental Mutation 'R2971:Gdf10'
ID265688
Institutional Source Beutler Lab
Gene Symbol Gdf10
Ensembl Gene ENSMUSG00000021943
Gene Namegrowth differentiation factor 10
Synonyms
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33923587-33937983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33924191 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 99 (R99H)
Ref Sequence ENSEMBL: ENSMUSP00000128621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168727]
Predicted Effect probably damaging
Transcript: ENSMUST00000168727
AA Change: R99H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128621
Gene: ENSMUSG00000021943
AA Change: R99H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
TGFB 374 476 1e-50 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein has been shown to promote neural repair after stroke and may act as a tumor suppressor. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Gdf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Gdf10 APN 14 33923980 missense probably benign
IGL03203:Gdf10 APN 14 33934473 missense possibly damaging 0.94
R0178:Gdf10 UTSW 14 33924101 missense probably damaging 1.00
R0890:Gdf10 UTSW 14 33932156 missense possibly damaging 0.57
R1218:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1219:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1221:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1670:Gdf10 UTSW 14 33932043 missense possibly damaging 0.92
R1956:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1957:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R1958:Gdf10 UTSW 14 33932753 missense probably benign 0.01
R2154:Gdf10 UTSW 14 33934389 missense probably damaging 0.99
R2260:Gdf10 UTSW 14 33932277 missense probably damaging 1.00
R3896:Gdf10 UTSW 14 33934481 missense probably damaging 1.00
R4027:Gdf10 UTSW 14 33932615 missense probably damaging 1.00
R4393:Gdf10 UTSW 14 33932738 missense probably damaging 1.00
R4782:Gdf10 UTSW 14 33931913 missense probably benign 0.00
R5436:Gdf10 UTSW 14 33932256 missense probably damaging 0.97
R5829:Gdf10 UTSW 14 33932717 missense probably damaging 0.99
R6387:Gdf10 UTSW 14 33924004 missense probably benign 0.05
Z1088:Gdf10 UTSW 14 33932390 missense probably damaging 1.00
Z1176:Gdf10 UTSW 14 33932532 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCACCGTTACTCAGCCATG -3'
(R):5'- CTTGTCCCAACTGCAAGCTCTG -3'

Sequencing Primer
(F):5'- GTCCTGCTCGGATCAGCTTG -3'
(R):5'- AAGCTCTGGCCTGGTTCAG -3'
Posted On2015-02-05