Incidental Mutation 'R2971:Psmb11'
ID265692
Institutional Source Beutler Lab
Gene Symbol Psmb11
Ensembl Gene ENSMUSG00000072423
Gene Nameproteasome (prosome, macropain) subunit, beta type, 11
Synonyms5830406J20Rik, beta5t
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2971 (G1)
Quality Score208
Status Validated
Chromosome14
Chromosomal Location54621433-54629556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54625343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6 (V6A)
Ref Sequence ENSEMBL: ENSMUSP00000132140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097177] [ENSMUST00000228446]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097177
AA Change: V6A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132140
Gene: ENSMUSG00000072423
AA Change: V6A

DomainStartEndE-ValueType
Pfam:Proteasome 46 228 3.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228446
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteasomes generate peptides that are presented by major histocompatibility complex (MHC) I molecules to other cells of the immune system. Proteolysis is conducted by 20S proteasomes, complexes of 28 subunits arranged as a cylinder in 4 heteroheptameric rings: alpha-1 to -7, beta-1 to -7, beta-1 to -7, and alpha-1 to -7. The catalytic subunits are beta-1 (PSMB6; MIM 600307), beta-2 (PSMB7; MIM 604030), and beta-5 (PSMB5; MIM 600306). Three additional subunits, beta-1i (PSMB9; MIM 177045), beta-2i (PSMB10; MIM 176847), and beta-5i (PSMB8; MIM 177046), are induced by gamma-interferon (IFNG; MIM 147570) and are preferentially incorporated into proteasomes to make immunoproteasomes. PSMB11, or beta-5t, is a catalytic subunit expressed exclusively in cortical thymic epithelial cells (Murata et al., 2007 [PubMed 17540904]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele have fewer CD8+ single positive cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Ifit3b C T 19: 34,612,017 Q198* probably null Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Psmb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Psmb11 APN 14 54625651 missense probably damaging 0.98
IGL03057:Psmb11 APN 14 54625779 nonsense probably null
R4006:Psmb11 UTSW 14 54625646 missense probably damaging 0.99
R6228:Psmb11 UTSW 14 54626189 missense probably benign
R7229:Psmb11 UTSW 14 54625951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGCCTGATCTGAGACC -3'
(R):5'- TGGACATGCCACATAGCTGC -3'

Sequencing Primer
(F):5'- CCAAGGAGAAATGAAGCTTAGCTCAC -3'
(R):5'- AGTATCAGCCGCAGCGATGAC -3'
Posted On2015-02-05