Incidental Mutation 'R2971:Ifit3b'
ID265693
Institutional Source Beutler Lab
Gene Symbol Ifit3b
Ensembl Gene ENSMUSG00000062488
Gene Nameinterferon-induced protein with tetratricopeptide repeats 3B
SynonymsI830012O16Rik
MMRRC Submission 040525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2971 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34607970-34613401 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 34612017 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 198 (Q198*)
Ref Sequence ENSEMBL: ENSMUSP00000075599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076249]
Predicted Effect probably null
Transcript: ENSMUST00000076249
AA Change: Q198*
SMART Domains Protein: ENSMUSP00000075599
Gene: ENSMUSG00000062488
AA Change: Q198*

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 5e-6 BLAST
TPR 241 274 1.02e1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,699 D1406G possibly damaging Het
Aebp2 T C 6: 140,633,898 probably null Het
Ap5m1 T A 14: 49,083,882 Y49* probably null Het
Atp8b5 T C 4: 43,361,953 probably benign Het
Baz1a A G 12: 54,923,439 S518P probably damaging Het
Ces1c T A 8: 93,104,193 D445V probably benign Het
Ctnnbl1 C T 2: 157,871,186 H464Y probably benign Het
Cyp2j6 T C 4: 96,531,781 K238E probably benign Het
Gdf10 G A 14: 33,924,191 R99H probably damaging Het
Gm4779 G A X: 101,792,962 P116L possibly damaging Het
Gucy2g A G 19: 55,210,276 S812P probably damaging Het
Irgm1 A T 11: 48,866,590 Y131* probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Myh7b A G 2: 155,632,255 N1630S probably benign Het
Myo5a T C 9: 75,116,202 I15T probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nme6 A G 9: 109,842,091 probably benign Het
Olfr1040 T C 2: 86,146,564 T57A probably damaging Het
Olfr741 T A 14: 50,485,608 I50N probably damaging Het
Plch2 T G 4: 154,990,767 M797L probably benign Het
Plscr2 G T 9: 92,290,671 E128* probably null Het
Plxna2 T A 1: 194,797,731 D1403E probably damaging Het
Pou6f2 T C 13: 18,381,967 T25A unknown Het
Psmb11 T C 14: 54,625,343 V6A possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprd T G 4: 76,107,324 S546R probably benign Het
Rbp3 A G 14: 33,954,454 N120D probably benign Het
Skint1 C A 4: 112,021,330 P153H possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tmem201 A G 4: 149,722,445 probably benign Het
Ube2v1 T C 2: 167,610,336 N89D probably damaging Het
Zfp282 A T 6: 47,897,932 probably null Het
Zfp560 C A 9: 20,348,944 M207I probably benign Het
Zfp697 T C 3: 98,428,301 Y461H probably damaging Het
Other mutations in Ifit3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
Galilee UTSW 19 34611525 missense probably benign
negev UTSW 19 34611460 missense probably benign 0.14
R1528:Ifit3b UTSW 19 34611672 missense probably benign 0.05
R1996:Ifit3b UTSW 19 34611477 missense probably damaging 1.00
R2680:Ifit3b UTSW 19 34612305 missense probably benign 0.01
R4395:Ifit3b UTSW 19 34612551 nonsense probably null
R4719:Ifit3b UTSW 19 34612630 missense probably damaging 0.96
R4726:Ifit3b UTSW 19 34611460 missense probably benign 0.14
R5094:Ifit3b UTSW 19 34612548 missense possibly damaging 0.93
R5958:Ifit3b UTSW 19 34611742 missense probably benign 0.02
R5987:Ifit3b UTSW 19 34612198 missense probably damaging 1.00
R6381:Ifit3b UTSW 19 34612471 missense probably benign 0.00
R6614:Ifit3b UTSW 19 34611519 missense probably benign 0.01
R6662:Ifit3b UTSW 19 34611937 missense probably damaging 1.00
R6804:Ifit3b UTSW 19 34611547 missense possibly damaging 0.92
R6847:Ifit3b UTSW 19 34611525 missense probably benign
R7685:Ifit3b UTSW 19 34612555 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCCCAGAACTTGAATGTGAG -3'
(R):5'- ATCGCAGTGCTTTTCCAAGTAAC -3'

Sequencing Primer
(F):5'- CCCAGAACTTGAATGTGAGGAAGG -3'
(R):5'- AACTCAATAGCTCTGTCTAGGTTACC -3'
Posted On2015-02-05