Incidental Mutation 'R3016:Alkbh8'
ID265706
Institutional Source Beutler Lab
Gene Symbol Alkbh8
Ensembl Gene ENSMUSG00000025899
Gene NamealkB homolog 8, tRNA methyltransferase
Synonyms4930562C03Rik, Abh8, 9430088N01Rik, 8030431D03Rik
MMRRC Submission 040537-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3016 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location3335140-3391154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3369658 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 309 (S309I)
Ref Sequence ENSEMBL: ENSMUSP00000148380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053407] [ENSMUST00000165105] [ENSMUST00000211933] [ENSMUST00000212294] [ENSMUST00000212358] [ENSMUST00000212817]
Predicted Effect probably benign
Transcript: ENSMUST00000053407
AA Change: S344I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061511
Gene: ENSMUSG00000025899
AA Change: S344I

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 8.7e-27 PFAM
Pfam:2OG-FeII_Oxy 220 336 1.8e-11 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_23 386 534 1e-9 PFAM
Pfam:Methyltransf_31 404 547 3.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.7e-9 PFAM
Pfam:Methyltransf_11 411 501 5.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165105
AA Change: S344I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125996
Gene: ENSMUSG00000025899
AA Change: S344I

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 1.6e-24 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.5e-9 PFAM
Pfam:Methyltransf_11 411 501 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211933
AA Change: S344I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000212294
AA Change: S309I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000212358
Predicted Effect probably benign
Transcript: ENSMUST00000212817
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants show no obvious phenotype at 20 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,899,222 D74G probably benign Het
Asgr2 A T 11: 70,105,409 I226F probably damaging Het
Cep250 A G 2: 155,991,288 E1690G probably damaging Het
Fancd2 T C 6: 113,536,726 V71A probably benign Het
Foxo3 G T 10: 42,197,356 D388E probably benign Het
Gna14 A T 19: 16,603,382 I195F probably benign Het
Hecw2 T C 1: 53,830,680 D1463G probably damaging Het
Idi2 T C 13: 8,959,430 *228R probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lag3 A G 6: 124,908,466 V317A probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr169 A G 16: 19,566,391 L164P probably damaging Het
Olfr968 A T 9: 39,772,683 V39E probably benign Het
Padi3 G T 4: 140,786,587 F593L probably damaging Het
Piezo1 A G 8: 122,506,027 probably null Het
Piezo2 G A 18: 63,042,832 T1826I probably damaging Het
Pkhd1l1 G A 15: 44,545,370 A2418T probably benign Het
Pole2 A G 12: 69,222,062 M111T probably benign Het
Ptprb T C 10: 116,357,295 S1901P possibly damaging Het
Rapgef1 G A 2: 29,707,393 R588Q probably damaging Het
Tmed6 A G 8: 107,065,437 F59L probably damaging Het
Xpo5 A G 17: 46,220,831 D431G probably damaging Het
Other mutations in Alkbh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Alkbh8 APN 9 3359588 missense probably damaging 1.00
IGL01419:Alkbh8 APN 9 3385354 missense probably damaging 1.00
IGL01457:Alkbh8 APN 9 3369825 missense probably damaging 1.00
IGL02398:Alkbh8 APN 9 3345870 missense possibly damaging 0.77
IGL02503:Alkbh8 APN 9 3347852 missense probably damaging 1.00
IGL02824:Alkbh8 APN 9 3368021 splice site probably null
IGL03001:Alkbh8 APN 9 3344602 missense probably benign
IGL03055:Alkbh8 APN 9 3345882 splice site probably benign
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0403:Alkbh8 UTSW 9 3385469 missense probably damaging 1.00
R1331:Alkbh8 UTSW 9 3347916 splice site probably null
R1688:Alkbh8 UTSW 9 3382765 missense probably damaging 1.00
R1859:Alkbh8 UTSW 9 3385499 missense probably benign 0.07
R2014:Alkbh8 UTSW 9 3343216 nonsense probably null
R3722:Alkbh8 UTSW 9 3385153 missense probably damaging 1.00
R4744:Alkbh8 UTSW 9 3344604 nonsense probably null
R4840:Alkbh8 UTSW 9 3369751 missense probably damaging 1.00
R5403:Alkbh8 UTSW 9 3385318 missense probably benign 0.00
R5644:Alkbh8 UTSW 9 3385384 missense probably damaging 1.00
R5677:Alkbh8 UTSW 9 3385147 missense possibly damaging 0.93
R5902:Alkbh8 UTSW 9 3385414 missense probably benign 0.04
R6293:Alkbh8 UTSW 9 3347841 missense possibly damaging 0.52
R7352:Alkbh8 UTSW 9 3345796 missense probably damaging 0.99
R7457:Alkbh8 UTSW 9 3343056 missense probably damaging 0.99
R7869:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R7887:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R8052:Alkbh8 UTSW 9 3385478 missense probably damaging 1.00
R8506:Alkbh8 UTSW 9 3335616 unclassified probably benign
X0028:Alkbh8 UTSW 9 3369767 missense probably benign 0.01
X0062:Alkbh8 UTSW 9 3359532 missense probably null 1.00
Z1176:Alkbh8 UTSW 9 3345820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAGACCCTGTACCATACATG -3'
(R):5'- CAGGAACTCTACTATGCGTGGC -3'

Sequencing Primer
(F):5'- gggtttcactctgtaagc -3'
(R):5'- AACTCTACTATGCGTGGCCATGG -3'
Posted On2015-02-05