Mutagenetix > Incidental Mutation

Incidental Mutation 'R3016:Ptprb'

265711

Institutional Source

Beutler Lab

Gene Symbol

Ptprb

Ensembl Gene

ENSMUSG00000020154

Gene Name

protein tyrosine phosphatase, receptor type, B

Synonyms

3230402H02Rik, VE-PTP

MMRRC Submission

040537-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3016 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116275523-116389535 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116357295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1901 (S1901P)

Ref Sequence

ENSEMBL: ENSMUSP00000151821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]

AlphaFold

B2RU80

Predicted Effect

probably benign
Transcript: ENSMUST00000092167
AA Change: S1614P

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: S1614P

Domain	Start	End	E-Value	Type
FN3	22	102	8.23e1	SMART
FN3	111	193	1.73e-5	SMART
FN3	204	281	1.56e-3	SMART
FN3	290	366	6.45e-5	SMART
FN3	378	459	5e-2	SMART
FN3	468	546	1.61e-5	SMART
FN3	555	632	7.18e-3	SMART
FN3	644	724	7.52e-6	SMART
FN3	732	811	2.92e-3	SMART
FN3	820	899	2.76e-4	SMART
FN3	908	987	1.29e-4	SMART
FN3	996	1075	7.7e-3	SMART
FN3	1086	1166	1.21e0	SMART
FN3	1174	1253	5.08e-3	SMART
FN3	1262	1340	1.17e-7	SMART
FN3	1356	1435	2.68e-2	SMART
Blast:FN3	1450	1591	6e-88	BLAST
transmembrane domain	1620	1642	N/A	INTRINSIC
Blast:PTPc	1643	1681	3e-11	BLAST
PTPc	1703	1966	1.05e-134	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218553
AA Change: S1901P

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,899,222	D74G	probably benign	Het
Alkbh8	G	T	9: 3,369,658	S309I	probably benign	Het
Asgr2	A	T	11: 70,105,409	I226F	probably damaging	Het
Cep250	A	G	2: 155,991,288	E1690G	probably damaging	Het
Fancd2	T	C	6: 113,536,726	V71A	probably benign	Het
Foxo3	G	T	10: 42,197,356	D388E	probably benign	Het
Gna14	A	T	19: 16,603,382	I195F	probably benign	Het
Hecw2	T	C	1: 53,830,680	D1463G	probably damaging	Het
Idi2	T	C	13: 8,959,430	*228R	probably null	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Lag3	A	G	6: 124,908,466	V317A	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Olfr169	A	G	16: 19,566,391	L164P	probably damaging	Het
Olfr968	A	T	9: 39,772,683	V39E	probably benign	Het
Padi3	G	T	4: 140,786,587	F593L	probably damaging	Het
Piezo1	A	G	8: 122,506,027		probably null	Het
Piezo2	G	A	18: 63,042,832	T1826I	probably damaging	Het
Pkhd1l1	G	A	15: 44,545,370	A2418T	probably benign	Het
Pole2	A	G	12: 69,222,062	M111T	probably benign	Het
Rapgef1	G	A	2: 29,707,393	R588Q	probably damaging	Het
Tmed6	A	G	8: 107,065,437	F59L	probably damaging	Het
Xpo5	A	G	17: 46,220,831	D431G	probably damaging	Het

Other mutations in Ptprb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Ptprb	APN	10	116362648	missense	probably benign	0.15
IGL01354:Ptprb	APN	10	116343891	missense	probably benign	0.24
IGL01404:Ptprb	APN	10	116339436	missense	probably benign	0.14
IGL01410:Ptprb	APN	10	116302274	missense	possibly damaging	0.60
IGL01412:Ptprb	APN	10	116343915	missense	probably benign	0.27
IGL01731:Ptprb	APN	10	116372876	missense	probably damaging	1.00
IGL02003:Ptprb	APN	10	116367505	missense	probably damaging	1.00
IGL02110:Ptprb	APN	10	116331203	splice site	probably benign
IGL02178:Ptprb	APN	10	116322532	missense	probably benign	0.00
IGL02304:Ptprb	APN	10	116331259	missense	probably damaging	1.00
IGL02324:Ptprb	APN	10	116319333	missense	probably benign	0.03
IGL02388:Ptprb	APN	10	116367521	missense	probably damaging	1.00
IGL02640:Ptprb	APN	10	116338664	missense	probably damaging	0.99
IGL02698:Ptprb	APN	10	116363280	missense	probably benign	0.05
IGL02876:Ptprb	APN	10	116348211	splice site	probably benign
IGL02879:Ptprb	APN	10	116327968	missense	probably benign
IGL02982:Ptprb	APN	10	116322628	missense	probably benign	0.20
IGL03146:Ptprb	APN	10	116328127	missense	probably benign	0.14
IGL03351:Ptprb	APN	10	116339582	missense	probably benign	0.03
R0306:Ptprb	UTSW	10	116343988	missense	probably benign	0.04
R0385:Ptprb	UTSW	10	116350178	missense	probably benign	0.00
R0600:Ptprb	UTSW	10	116368807	missense	possibly damaging	0.63
R0613:Ptprb	UTSW	10	116302325	missense	possibly damaging	0.59
R0613:Ptprb	UTSW	10	116302378	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116302125	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116339510	missense	probably damaging	1.00
R1331:Ptprb	UTSW	10	116367532	missense	probably damaging	1.00
R1413:Ptprb	UTSW	10	116339679	missense	probably damaging	1.00
R1418:Ptprb	UTSW	10	116319470	missense	probably benign	0.00
R1545:Ptprb	UTSW	10	116380869	missense	probably damaging	1.00
R1562:Ptprb	UTSW	10	116339467	missense	probably benign	0.00
R1752:Ptprb	UTSW	10	116340990	missense	probably benign	0.44
R1837:Ptprb	UTSW	10	116341626	missense	probably benign	0.00
R1940:Ptprb	UTSW	10	116319610	splice site	probably benign
R1958:Ptprb	UTSW	10	116341536	missense	probably benign	0.10
R2029:Ptprb	UTSW	10	116347053	missense	probably benign	0.37
R2031:Ptprb	UTSW	10	116317543	missense	probably benign
R2101:Ptprb	UTSW	10	116315038	splice site	probably benign
R2209:Ptprb	UTSW	10	116369357	missense	probably damaging	1.00
R3076:Ptprb	UTSW	10	116344026	missense	probably damaging	0.99
R3821:Ptprb	UTSW	10	116350074	missense	probably benign	0.11
R3824:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3825:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3841:Ptprb	UTSW	10	116346982	missense	possibly damaging	0.79
R3953:Ptprb	UTSW	10	116341494	missense	probably benign	0.00
R4125:Ptprb	UTSW	10	116353849	missense	probably benign	0.12
R4227:Ptprb	UTSW	10	116302225	missense	possibly damaging	0.96
R4385:Ptprb	UTSW	10	116346867	missense	probably benign
R4731:Ptprb	UTSW	10	116319333	missense	probably benign	0.03
R5009:Ptprb	UTSW	10	116348127	missense	possibly damaging	0.61
R5104:Ptprb	UTSW	10	116322459	missense	probably benign	0.17
R5114:Ptprb	UTSW	10	116348183	missense	possibly damaging	0.59
R5145:Ptprb	UTSW	10	116343915	missense	probably benign	0.27
R5214:Ptprb	UTSW	10	116369324	missense	possibly damaging	0.75
R5382:Ptprb	UTSW	10	116353871	missense	probably damaging	1.00
R5553:Ptprb	UTSW	10	116350185	missense	probably damaging	1.00
R5585:Ptprb	UTSW	10	116380854	missense	probably damaging	0.98
R5586:Ptprb	UTSW	10	116353827	missense	probably damaging	1.00
R5808:Ptprb	UTSW	10	116339487	missense	probably benign	0.00
R5875:Ptprb	UTSW	10	116348166	missense	probably benign	0.00
R6051:Ptprb	UTSW	10	116341090	nonsense	probably null
R6383:Ptprb	UTSW	10	116347007	nonsense	probably null
R6511:Ptprb	UTSW	10	116346820	missense	probably damaging	1.00
R6817:Ptprb	UTSW	10	116283677	small deletion	probably benign
R6826:Ptprb	UTSW	10	116317372	missense	probably benign	0.26
R6958:Ptprb	UTSW	10	116277248	missense	probably benign	0.32
R7103:Ptprb	UTSW	10	116338813	missense	probably damaging	1.00
R7129:Ptprb	UTSW	10	116283677	small deletion	probably benign
R7181:Ptprb	UTSW	10	116368766	missense	probably damaging	1.00
R7215:Ptprb	UTSW	10	116338776	missense	possibly damaging	0.94
R7289:Ptprb	UTSW	10	116328165	missense	probably damaging	0.99
R7315:Ptprb	UTSW	10	116362379	missense	possibly damaging	0.83
R7319:Ptprb	UTSW	10	116341404	missense	probably benign	0.01
R7381:Ptprb	UTSW	10	116341133	missense	probably benign
R7412:Ptprb	UTSW	10	116341138	missense	probably benign
R7483:Ptprb	UTSW	10	116283429	missense	probably benign	0.01
R7495:Ptprb	UTSW	10	116341448	missense	probably benign	0.12
R7508:Ptprb	UTSW	10	116353991	nonsense	probably null
R7571:Ptprb	UTSW	10	116339430	missense	probably damaging	1.00
R7586:Ptprb	UTSW	10	116343874	missense	probably damaging	0.97
R7623:Ptprb	UTSW	10	116369309	missense	possibly damaging	0.63
R7694:Ptprb	UTSW	10	116372948	missense	probably damaging	1.00
R7744:Ptprb	UTSW	10	116277484	missense	probably benign	0.10
R7752:Ptprb	UTSW	10	116369428	missense	probably benign	0.37
R7826:Ptprb	UTSW	10	116283677	small deletion	probably benign
R7833:Ptprb	UTSW	10	116315251	missense	probably benign	0.01
R7834:Ptprb	UTSW	10	116339424	missense	probably benign	0.00
R7846:Ptprb	UTSW	10	116283548	missense	probably benign	0.17
R7896:Ptprb	UTSW	10	116369457	splice site	probably null
R7901:Ptprb	UTSW	10	116369428	missense	probably benign	0.37
R7912:Ptprb	UTSW	10	116322487	missense	probably damaging	1.00
R7941:Ptprb	UTSW	10	116283677	small deletion	probably benign
R8147:Ptprb	UTSW	10	116317378	missense	probably damaging	1.00
R8202:Ptprb	UTSW	10	116353845	missense	probably damaging	1.00
R8339:Ptprb	UTSW	10	116283451	missense	probably benign	0.14
R8400:Ptprb	UTSW	10	116283572	small deletion	probably benign
R8504:Ptprb	UTSW	10	116341031	missense	probably benign	0.27
R8679:Ptprb	UTSW	10	116367590	missense	probably damaging	1.00
R8786:Ptprb	UTSW	10	116319401	missense	probably benign	0.40
R8914:Ptprb	UTSW	10	116322662	nonsense	probably null
R8980:Ptprb	UTSW	10	116283621	missense	probably benign	0.07
R8982:Ptprb	UTSW	10	116283677	small deletion	probably benign
R9256:Ptprb	UTSW	10	116383871	missense	probably damaging	1.00
R9288:Ptprb	UTSW	10	116319448	missense	probably benign	0.03
R9369:Ptprb	UTSW	10	116315152	missense	probably benign	0.00
R9448:Ptprb	UTSW	10	116313914	nonsense	probably null
R9467:Ptprb	UTSW	10	116322485	missense	probably benign	0.00
R9468:Ptprb	UTSW	10	116277369	missense	probably benign	0.00
R9481:Ptprb	UTSW	10	116319448	missense	probably benign	0.03
R9486:Ptprb	UTSW	10	116319589	nonsense	probably null
R9513:Ptprb	UTSW	10	116302237	missense	probably benign	0.00
R9529:Ptprb	UTSW	10	116338614	critical splice acceptor site	probably null
R9535:Ptprb	UTSW	10	116322526	missense	possibly damaging	0.92
R9614:Ptprb	UTSW	10	116367536	missense	probably damaging	1.00
R9686:Ptprb	UTSW	10	116368789	missense	probably damaging	1.00
RF041:Ptprb	UTSW	10	116283677	small deletion	probably benign
X0020:Ptprb	UTSW	10	116302180	missense	possibly damaging	0.62
Z1176:Ptprb	UTSW	10	116302156	frame shift	probably null
Z1177:Ptprb	UTSW	10	116362642	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCATATCTCACCCTAGGTACAGAAC -3'
(R):5'- AGCTGCTATAATCTCTCTGATCCAC -3'

Sequencing Primer
(F):5'- CCTTGAACACAGTCTTCAGCC -3'
(R):5'- TCTCTGATCCACACAATCCATGG -3'

Posted On

2015-02-05