Incidental Mutation 'R3016:Pole2'
ID 265715
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Name polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms DNA polymerase epsilon small subunit
MMRRC Submission 040537-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3016 (G1)
Quality Score 193
Status Not validated
Chromosome 12
Chromosomal Location 69201773-69228195 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69222062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 111 (M111T)
Ref Sequence ENSEMBL: ENSMUSP00000021359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]
AlphaFold O54956
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: M111T

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: M111T

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: M111T

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,899,222 D74G probably benign Het
Alkbh8 G T 9: 3,369,658 S309I probably benign Het
Asgr2 A T 11: 70,105,409 I226F probably damaging Het
Cep250 A G 2: 155,991,288 E1690G probably damaging Het
Fancd2 T C 6: 113,536,726 V71A probably benign Het
Foxo3 G T 10: 42,197,356 D388E probably benign Het
Gna14 A T 19: 16,603,382 I195F probably benign Het
Hecw2 T C 1: 53,830,680 D1463G probably damaging Het
Idi2 T C 13: 8,959,430 *228R probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lag3 A G 6: 124,908,466 V317A probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr169 A G 16: 19,566,391 L164P probably damaging Het
Olfr968 A T 9: 39,772,683 V39E probably benign Het
Padi3 G T 4: 140,786,587 F593L probably damaging Het
Piezo1 A G 8: 122,506,027 probably null Het
Piezo2 G A 18: 63,042,832 T1826I probably damaging Het
Pkhd1l1 G A 15: 44,545,370 A2418T probably benign Het
Ptprb T C 10: 116,357,295 S1901P possibly damaging Het
Rapgef1 G A 2: 29,707,393 R588Q probably damaging Het
Tmed6 A G 8: 107,065,437 F59L probably damaging Het
Xpo5 A G 17: 46,220,831 D431G probably damaging Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0574:Pole2 UTSW 12 69211457 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0685:Pole2 UTSW 12 69211413 missense probably damaging 0.98
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1452:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1455:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R2929:Pole2 UTSW 12 69209938 missense probably benign 0.13
R4504:Pole2 UTSW 12 69222468 missense probably benign 0.00
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
R7535:Pole2 UTSW 12 69222429 missense probably benign 0.10
R7841:Pole2 UTSW 12 69204258 missense probably damaging 1.00
R8437:Pole2 UTSW 12 69204187 nonsense probably null
R8506:Pole2 UTSW 12 69208960 missense probably benign
R9467:Pole2 UTSW 12 69208945 missense probably benign 0.40
R9494:Pole2 UTSW 12 69202957 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCAGACAGGGTCCTACTCC -3'
(R):5'- TTGGAGCTTTTGATATTCCACG -3'

Sequencing Primer
(F):5'- CTGCCTCTGTGATCTCAGGTATTG -3'
(R):5'- TGTAGCTACCATATGAGTCCCGG -3'
Posted On 2015-02-05