Incidental Mutation 'R3016:Olfr169'
ID265720
Institutional Source Beutler Lab
Gene Symbol Olfr169
Ensembl Gene ENSMUSG00000068535
Gene Nameolfactory receptor 169
SynonymsGA_x54KRFPKG5P-16014972-16014031, MOR273-3P
MMRRC Submission 040537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3016 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19564889-19571809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19566391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 164 (L164P)
Ref Sequence ENSEMBL: ENSMUSP00000150528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090062] [ENSMUST00000215040] [ENSMUST00000215476] [ENSMUST00000216070]
Predicted Effect probably damaging
Transcript: ENSMUST00000090062
AA Change: L164P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087516
Gene: ENSMUSG00000068535
AA Change: L164P

DomainStartEndE-ValueType
Pfam:7tm_4 28 308 1.3e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2e-6 PFAM
Pfam:7tm_1 41 290 7.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215040
AA Change: L164P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215476
AA Change: L164P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216070
AA Change: L164P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,899,222 D74G probably benign Het
Alkbh8 G T 9: 3,369,658 S309I probably benign Het
Asgr2 A T 11: 70,105,409 I226F probably damaging Het
Cep250 A G 2: 155,991,288 E1690G probably damaging Het
Fancd2 T C 6: 113,536,726 V71A probably benign Het
Foxo3 G T 10: 42,197,356 D388E probably benign Het
Gna14 A T 19: 16,603,382 I195F probably benign Het
Hecw2 T C 1: 53,830,680 D1463G probably damaging Het
Idi2 T C 13: 8,959,430 *228R probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lag3 A G 6: 124,908,466 V317A probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr968 A T 9: 39,772,683 V39E probably benign Het
Padi3 G T 4: 140,786,587 F593L probably damaging Het
Piezo1 A G 8: 122,506,027 probably null Het
Piezo2 G A 18: 63,042,832 T1826I probably damaging Het
Pkhd1l1 G A 15: 44,545,370 A2418T probably benign Het
Pole2 A G 12: 69,222,062 M111T probably benign Het
Ptprb T C 10: 116,357,295 S1901P possibly damaging Het
Rapgef1 G A 2: 29,707,393 R588Q probably damaging Het
Tmed6 A G 8: 107,065,437 F59L probably damaging Het
Xpo5 A G 17: 46,220,831 D431G probably damaging Het
Other mutations in Olfr169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Olfr169 APN 16 19566208 missense probably damaging 1.00
IGL01862:Olfr169 APN 16 19566676 missense probably damaging 1.00
IGL02064:Olfr169 APN 16 19566548 missense probably damaging 1.00
IGL03061:Olfr169 APN 16 19566713 missense possibly damaging 0.87
IGL03136:Olfr169 APN 16 19566353 missense probably damaging 1.00
R0066:Olfr169 UTSW 16 19566049 missense probably damaging 1.00
R0243:Olfr169 UTSW 16 19566294 missense probably damaging 0.97
R0629:Olfr169 UTSW 16 19565980 missense possibly damaging 0.88
R1644:Olfr169 UTSW 16 19566406 missense probably benign 0.11
R1943:Olfr169 UTSW 16 19566437 missense probably benign 0.19
R4290:Olfr169 UTSW 16 19566244 missense possibly damaging 0.88
R4689:Olfr169 UTSW 16 19566513 nonsense probably null
R4791:Olfr169 UTSW 16 19566663 missense possibly damaging 0.50
R5497:Olfr169 UTSW 16 19566330 missense probably benign 0.10
R5843:Olfr169 UTSW 16 19566583 missense probably damaging 1.00
R6106:Olfr169 UTSW 16 19566259 missense probably damaging 0.99
R6249:Olfr169 UTSW 16 19565975 missense probably damaging 0.99
R7895:Olfr169 UTSW 16 19566722 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCTGATGACTGCATTTGG -3'
(R):5'- GGCTGTGCCTTCCAGATATTTC -3'

Sequencing Primer
(F):5'- CCCTGATGACTGCATTTGGAATACAG -3'
(R):5'- GTGCCTTCCAGATATTTCTCTCTC -3'
Posted On2015-02-05