Mutagenetix > Incidental Mutation

Incidental Mutation 'R3023:Cc2d2a'

ID

265749

Institutional Source

Beutler Lab

Gene Symbol

Cc2d2a

Ensembl Gene

ENSMUSG00000039765

Gene Name

coiled-coil and C2 domain containing 2A

Synonyms

b2b1035Clo, 5730509K17Rik

MMRRC Submission

040539-MU

Accession Numbers

Genbank: NM_172274; MGI: 1924487

Essential gene?

Probably essential (E-score: 0.900) question?

question?

Stock #

R3023 (G1)

Quality Score

225

Status

Not validated

Chromosome

5

Chromosomal Location

43662346-43740972 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 43685251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000048150] [ENSMUST00000048150] [ENSMUST00000125866] [ENSMUST00000125866] [ENSMUST00000125866] [ENSMUST00000125866] [ENSMUST00000125866] [ENSMUST00000125866]

Predicted Effect

probably null
Transcript: ENSMUST00000048150

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000048150

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000048150

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125866

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142303

Predicted Effect

probably null
Transcript: ENSMUST00000156034

SMART Domains

Protein: ENSMUSP00000118705
Gene: ENSMUSG00000039765

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,669,572	E1060D	probably benign	Het
Abca15	A	T	7: 120,382,779	I1106F	probably benign	Het
Arl5a	A	G	2: 52,416,197	V41A	probably benign	Het
Atp8b5	A	G	4: 43,311,957	D190G	possibly damaging	Het
Ckap2	T	C	8: 22,175,861	N390S	possibly damaging	Het
Dtx3l	A	G	16: 35,932,436	I600T	probably benign	Het
Epb41l1	A	C	2: 156,514,209	E555A	probably damaging	Het
Fxr1	G	A	3: 34,064,224	R503H	probably damaging	Het
Igf1r	A	G	7: 68,183,399	N436D	probably benign	Het
Kif26b	G	A	1: 178,864,868	C11Y	probably damaging	Het
Olfr1251	A	G	2: 89,667,646	I80T	possibly damaging	Het
Osbpl6	A	T	2: 76,586,733	I703F	probably damaging	Het
Plcd4	A	G	1: 74,548,192	Y37C	probably damaging	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Pwwp2b	G	A	7: 139,256,194	R517H	probably damaging	Het
Rp1	G	A	1: 4,352,675	R61W	probably damaging	Het
Sdk1	C	G	5: 142,046,236	T1022S	probably benign	Het
Slc12a7	T	A	13: 73,800,422	S669T	probably benign	Het
Sstr3	G	A	15: 78,539,987	R187W	probably damaging	Het
Tlr2	C	T	3: 83,837,871	V302I	probably benign	Het
Trav7-6	A	G	14: 53,717,244	K77R	probably benign	Het
Vmn2r18	T	C	5: 151,561,683	N782S	probably benign	Het
Vmn2r78	G	T	7: 86,954,966	S784I	probably damaging	Het

Other mutations in Cc2d2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cc2d2a	APN	5	43724380	splice site	probably benign
IGL00937:Cc2d2a	APN	5	43688122	critical splice acceptor site	probably null
IGL01322:Cc2d2a	APN	5	43689003	missense	probably benign	0.00
IGL01349:Cc2d2a	APN	5	43723784	missense	probably benign	0.01
IGL01448:Cc2d2a	APN	5	43684185	missense	possibly damaging	0.65
IGL01871:Cc2d2a	APN	5	43688969	missense	probably damaging	0.98
IGL01947:Cc2d2a	APN	5	43688237	missense	probably damaging	0.96
IGL01976:Cc2d2a	APN	5	43683115	missense	probably benign	0.02
IGL02113:Cc2d2a	APN	5	43685248	splice site	probably null
IGL02364:Cc2d2a	APN	5	43735450	missense	probably damaging	1.00
IGL02448:Cc2d2a	APN	5	43683205	splice site	probably benign
IGL02458:Cc2d2a	APN	5	43718554	missense	probably benign	0.01
IGL02542:Cc2d2a	APN	5	43688910	splice site	probably benign
IGL02834:Cc2d2a	APN	5	43714521	nonsense	probably null
IGL02940:Cc2d2a	APN	5	43728294	splice site	probably null
IGL03003:Cc2d2a	APN	5	43671266	missense	probably benign	0.22
IGL03183:Cc2d2a	APN	5	43732379	missense	probably damaging	1.00
C9142:Cc2d2a	UTSW	5	43735457	splice site	probably benign
P0028:Cc2d2a	UTSW	5	43684199	missense	probably benign
R0193:Cc2d2a	UTSW	5	43736118	missense	probably damaging	1.00
R0201:Cc2d2a	UTSW	5	43737512	missense	probably damaging	1.00
R0211:Cc2d2a	UTSW	5	43688266	splice site	probably null
R0243:Cc2d2a	UTSW	5	43696638	splice site	probably benign
R0317:Cc2d2a	UTSW	5	43706901	critical splice donor site	probably null
R0453:Cc2d2a	UTSW	5	43703294	missense	probably benign	0.00
R0558:Cc2d2a	UTSW	5	43724387	splice site	probably benign
R0624:Cc2d2a	UTSW	5	43730029	missense	probably benign
R0634:Cc2d2a	UTSW	5	43681381	splice site	probably benign
R1503:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R1635:Cc2d2a	UTSW	5	43722470	missense	probably damaging	1.00
R1686:Cc2d2a	UTSW	5	43739371	missense	possibly damaging	0.81
R1707:Cc2d2a	UTSW	5	43723688	splice site	probably null
R1715:Cc2d2a	UTSW	5	43718661	missense	probably damaging	0.97
R1765:Cc2d2a	UTSW	5	43714531	missense	probably damaging	0.99
R1794:Cc2d2a	UTSW	5	43688252	missense	probably damaging	1.00
R1881:Cc2d2a	UTSW	5	43740828	missense	probably damaging	0.99
R1917:Cc2d2a	UTSW	5	43706222	missense	probably damaging	1.00
R2005:Cc2d2a	UTSW	5	43726373	critical splice donor site	probably null
R2201:Cc2d2a	UTSW	5	43684033	splice site	probably benign
R2244:Cc2d2a	UTSW	5	43732433	missense	probably damaging	1.00
R2368:Cc2d2a	UTSW	5	43703888	missense	probably benign
R2442:Cc2d2a	UTSW	5	43671305	critical splice donor site	probably null
R2511:Cc2d2a	UTSW	5	43735395	missense	probably damaging	0.99
R3147:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3148:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3426:Cc2d2a	UTSW	5	43736109	missense	probably benign	0.00
R3609:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3610:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3611:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3839:Cc2d2a	UTSW	5	43718714	missense	probably benign
R3870:Cc2d2a	UTSW	5	43718691	nonsense	probably null
R4334:Cc2d2a	UTSW	5	43683134	missense	probably benign	0.00
R4913:Cc2d2a	UTSW	5	43739323	missense	probably benign	0.12
R5179:Cc2d2a	UTSW	5	43688221	missense	possibly damaging	0.82
R5315:Cc2d2a	UTSW	5	43720433	missense	probably damaging	0.99
R5352:Cc2d2a	UTSW	5	43706213	missense	probably damaging	1.00
R5386:Cc2d2a	UTSW	5	43730041	missense	probably benign	0.01
R5538:Cc2d2a	UTSW	5	43695176	missense	possibly damaging	0.94
R5568:Cc2d2a	UTSW	5	43709091	missense	probably damaging	0.99
R5618:Cc2d2a	UTSW	5	43729907	missense	probably benign	0.00
R5653:Cc2d2a	UTSW	5	43722462	missense	possibly damaging	0.81
R5817:Cc2d2a	UTSW	5	43712418	missense	probably damaging	1.00
R5858:Cc2d2a	UTSW	5	43715775	missense	probably damaging	1.00
R5905:Cc2d2a	UTSW	5	43712426	missense	probably benign
R5912:Cc2d2a	UTSW	5	43720430	missense	probably damaging	0.97
R6073:Cc2d2a	UTSW	5	43729975	missense	probably damaging	1.00
R6084:Cc2d2a	UTSW	5	43668673	missense	probably benign
R6142:Cc2d2a	UTSW	5	43703198	missense	probably damaging	0.97
R6176:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.32
R6238:Cc2d2a	UTSW	5	43671235	missense	probably benign	0.11
R6381:Cc2d2a	UTSW	5	43715776	missense	possibly damaging	0.69
R6404:Cc2d2a	UTSW	5	43704074	missense	possibly damaging	0.58
R6455:Cc2d2a	UTSW	5	43739412	missense	possibly damaging	0.69
R6695:Cc2d2a	UTSW	5	43718677	missense	probably damaging	0.99
R6805:Cc2d2a	UTSW	5	43681331	missense	probably damaging	1.00
R6919:Cc2d2a	UTSW	5	43703215	missense	probably benign	0.19
R6970:Cc2d2a	UTSW	5	43718585	missense	probably damaging	1.00
R7024:Cc2d2a	UTSW	5	43733929	missense	probably benign	0.10
R7054:Cc2d2a	UTSW	5	43699979	nonsense	probably null
R7071:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.13
R7098:Cc2d2a	UTSW	5	43683139	missense	probably benign	0.00
R7366:Cc2d2a	UTSW	5	43729990	missense	probably damaging	1.00
R7908:Cc2d2a	UTSW	5	43706846	missense	probably benign	0.00
R7920:Cc2d2a	UTSW	5	43739309	missense	probably benign	0.09
R7950:Cc2d2a	UTSW	5	43695296	critical splice donor site	probably null
R8007:Cc2d2a	UTSW	5	43706100	missense	possibly damaging	0.71
R8117:Cc2d2a	UTSW	5	43712439	missense	probably damaging	1.00
R8123:Cc2d2a	UTSW	5	43710554	missense	probably benign
R8179:Cc2d2a	UTSW	5	43699953	missense	probably damaging	0.96
R8279:Cc2d2a	UTSW	5	43736145	missense	probably benign	0.01
R8293:Cc2d2a	UTSW	5	43688228	missense	probably damaging	0.97
R8480:Cc2d2a	UTSW	5	43685144	splice site	probably null
R8482:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R8731:Cc2d2a	UTSW	5	43735446	missense	probably damaging	1.00
R8780:Cc2d2a	UTSW	5	43739350	missense	probably damaging	1.00
R8784:Cc2d2a	UTSW	5	43703303	missense	possibly damaging	0.90
R8871:Cc2d2a	UTSW	5	43699943	missense	possibly damaging	0.71
R8972:Cc2d2a	UTSW	5	43710542	missense	probably benign
R9122:Cc2d2a	UTSW	5	43673739	missense	probably null	0.07
R9125:Cc2d2a	UTSW	5	43703221	missense	probably benign
R9203:Cc2d2a	UTSW	5	43733837	missense	probably benign	0.01
R9310:Cc2d2a	UTSW	5	43695146	missense	probably damaging	1.00
R9343:Cc2d2a	UTSW	5	43718657	missense	probably damaging	1.00
R9353:Cc2d2a	UTSW	5	43703349	critical splice donor site	probably null
Z1177:Cc2d2a	UTSW	5	43703204	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAATGTCACCTTCATCTGAAAAGG -3'
(R):5'- AGAGTACCTGTCAGCCGACTAG -3'

Sequencing Primer
(F):5'- ACAGAACCCATGGTGTTTGC -3'
(R):5'- ACTAGGCGTGAAGAGGATTTCTTTC -3'

Posted On

2015-02-05