Incidental Mutation 'R3023:Ckap2'
ID265757
Institutional Source Beutler Lab
Gene Symbol Ckap2
Ensembl Gene ENSMUSG00000037725
Gene Namecytoskeleton associated protein 2
SynonymsLB1
MMRRC Submission 040539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R3023 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22168160-22185819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22175861 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 390 (N390S)
Ref Sequence ENSEMBL: ENSMUSP00000039518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046916
AA Change: N390S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039518
Gene: ENSMUSG00000037725
AA Change: N390S

DomainStartEndE-ValueType
low complexity region 221 234 N/A INTRINSIC
Pfam:CKAP2_C 315 651 3.9e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211045
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that stabalizes microtubules and plays a role in the regulation of cell division. The encoded protein is itself regulated through phosphorylation at multiple serine and threonine residues. There is a pseudogene of this gene on chromosome 14. Alternative splicing results in multiple transcript variations. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,669,572 E1060D probably benign Het
Abca15 A T 7: 120,382,779 I1106F probably benign Het
Arl5a A G 2: 52,416,197 V41A probably benign Het
Atp8b5 A G 4: 43,311,957 D190G possibly damaging Het
Cc2d2a T A 5: 43,685,251 probably null Het
Dtx3l A G 16: 35,932,436 I600T probably benign Het
Epb41l1 A C 2: 156,514,209 E555A probably damaging Het
Fxr1 G A 3: 34,064,224 R503H probably damaging Het
Igf1r A G 7: 68,183,399 N436D probably benign Het
Kif26b G A 1: 178,864,868 C11Y probably damaging Het
Olfr1251 A G 2: 89,667,646 I80T possibly damaging Het
Osbpl6 A T 2: 76,586,733 I703F probably damaging Het
Plcd4 A G 1: 74,548,192 Y37C probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pwwp2b G A 7: 139,256,194 R517H probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Sdk1 C G 5: 142,046,236 T1022S probably benign Het
Slc12a7 T A 13: 73,800,422 S669T probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Tlr2 C T 3: 83,837,871 V302I probably benign Het
Trav7-6 A G 14: 53,717,244 K77R probably benign Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vmn2r78 G T 7: 86,954,966 S784I probably damaging Het
Other mutations in Ckap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Ckap2 APN 8 22169758 missense probably damaging 1.00
IGL01519:Ckap2 APN 8 22168898 missense probably benign 0.00
R0530:Ckap2 UTSW 8 22175972 splice site probably benign
R1638:Ckap2 UTSW 8 22175796 missense possibly damaging 0.84
R1965:Ckap2 UTSW 8 22175787 missense possibly damaging 0.95
R2047:Ckap2 UTSW 8 22168747 missense probably benign 0.03
R3843:Ckap2 UTSW 8 22175758 missense probably damaging 0.98
R4587:Ckap2 UTSW 8 22176976 missense probably benign
R4754:Ckap2 UTSW 8 22168895 missense possibly damaging 0.93
R4847:Ckap2 UTSW 8 22175068 missense probably damaging 0.98
R5354:Ckap2 UTSW 8 22177565 missense probably damaging 0.96
R5423:Ckap2 UTSW 8 22177196 missense probably benign 0.33
R5717:Ckap2 UTSW 8 22175047 missense probably damaging 0.98
R6518:Ckap2 UTSW 8 22173303 missense probably benign 0.41
R7088:Ckap2 UTSW 8 22169866 missense possibly damaging 0.59
R7466:Ckap2 UTSW 8 22177386 missense probably benign 0.02
R7943:Ckap2 UTSW 8 22175074 missense probably damaging 0.97
X0058:Ckap2 UTSW 8 22176798 missense probably benign
Z1176:Ckap2 UTSW 8 22169794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATAAAGATAAGGGCTCTACCAAG -3'
(R):5'- GTTTAGAACGATGGATAGACTTGAG -3'

Sequencing Primer
(F):5'- CAGAGGATCTGGGTTCAATTCCC -3'
(R):5'- ATCAAACCAGGGTCCTTTGG -3'
Posted On2015-02-05