Incidental Mutation 'R3023:Slc12a7'
ID265761
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Namesolute carrier family 12, member 7
SynonymsKcc4
MMRRC Submission 040539-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3023 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73733094-73816754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73800422 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 669 (S669T)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900]
Predicted Effect probably benign
Transcript: ENSMUST00000017900
AA Change: S669T

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: S669T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223454
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,669,572 E1060D probably benign Het
Abca15 A T 7: 120,382,779 I1106F probably benign Het
Arl5a A G 2: 52,416,197 V41A probably benign Het
Atp8b5 A G 4: 43,311,957 D190G possibly damaging Het
Cc2d2a T A 5: 43,685,251 probably null Het
Ckap2 T C 8: 22,175,861 N390S possibly damaging Het
Dtx3l A G 16: 35,932,436 I600T probably benign Het
Epb41l1 A C 2: 156,514,209 E555A probably damaging Het
Fxr1 G A 3: 34,064,224 R503H probably damaging Het
Igf1r A G 7: 68,183,399 N436D probably benign Het
Kif26b G A 1: 178,864,868 C11Y probably damaging Het
Olfr1251 A G 2: 89,667,646 I80T possibly damaging Het
Osbpl6 A T 2: 76,586,733 I703F probably damaging Het
Plcd4 A G 1: 74,548,192 Y37C probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pwwp2b G A 7: 139,256,194 R517H probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Sdk1 C G 5: 142,046,236 T1022S probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Tlr2 C T 3: 83,837,871 V302I probably benign Het
Trav7-6 A G 14: 53,717,244 K77R probably benign Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vmn2r78 G T 7: 86,954,966 S784I probably damaging Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73764068 intron probably benign
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R7958:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAATGGTACCACAAGGAAGTC -3'
(R):5'- TCAGATCTCTCCTCAGAAGGC -3'

Sequencing Primer
(F):5'- AAGTCCTGCTGCTCGAAC -3'
(R):5'- GATCTCTCCTCAGAAGGCCAAGAG -3'
Posted On2015-02-05