Incidental Mutation 'R3024:Or4c127'
ID 265767
Institutional Source Beutler Lab
Gene Symbol Or4c127
Ensembl Gene ENSMUSG00000051313
Gene Name olfactory receptor family 4 subfamily C member 127
Synonyms GA_x6K02T2Q125-51434523-51435437, Olfr1262, MOR234-1
MMRRC Submission 040540-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R3024 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89832752-89833666 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89833584 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 278 (N278I)
Ref Sequence ENSEMBL: ENSMUSP00000107133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061701] [ENSMUST00000111508] [ENSMUST00000131072] [ENSMUST00000213868]
AlphaFold Q8VGN2
Predicted Effect probably damaging
Transcript: ENSMUST00000061701
AA Change: N278I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052387
Gene: ENSMUSG00000051313
AA Change: N278I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 9.9e-24 PFAM
Pfam:7tm_4 134 275 1.3e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111508
AA Change: N278I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107133
Gene: ENSMUSG00000051313
AA Change: N278I

DomainStartEndE-ValueType
Pfam:7tm_4 25 300 6.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 7.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131072
SMART Domains Protein: ENSMUSP00000121666
Gene: ENSMUSG00000051313

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 171 1.7e-8 PFAM
Pfam:7tm_1 36 238 3.2e-22 PFAM
Pfam:7tm_4 134 240 5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,634,959 (GRCm39) E461G probably damaging Het
Bfsp1 A T 2: 143,687,879 (GRCm39) V182D probably benign Het
Birc6 T C 17: 74,915,214 (GRCm39) S1635P possibly damaging Het
Chil6 T C 3: 106,296,086 (GRCm39) D383G probably damaging Het
Itpr2 G A 6: 146,081,808 (GRCm39) A175V probably benign Het
Kcnh7 G T 2: 62,595,007 (GRCm39) R688S probably damaging Het
Krt6a A T 15: 101,599,724 (GRCm39) C463S probably benign Het
Ksr2 T A 5: 117,693,125 (GRCm39) I191N possibly damaging Het
Lyst T C 13: 13,833,272 (GRCm39) V1698A probably benign Het
Or12d13 A T 17: 37,647,918 (GRCm39) D68E probably damaging Het
Pappa2 C T 1: 158,763,795 (GRCm39) R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,927,719 (GRCm39) probably benign Het
Phf20 A G 2: 156,129,787 (GRCm39) H453R probably damaging Het
Prex1 G T 2: 166,430,956 (GRCm39) H615Q probably benign Het
Slc25a54 T A 3: 108,987,982 (GRCm39) I41N probably damaging Het
Slc35f5 A G 1: 125,496,335 (GRCm39) S157G probably benign Het
Sstr3 G A 15: 78,424,187 (GRCm39) R187W probably damaging Het
Trim41 T C 11: 48,698,985 (GRCm39) K420E possibly damaging Het
Tsnaxip1 A G 8: 106,568,375 (GRCm39) Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 (GRCm39) I36M probably benign Het
Xylt1 T A 7: 117,147,883 (GRCm39) V149D probably damaging Het
Zfpm2 G A 15: 40,966,355 (GRCm39) E815K probably benign Het
Other mutations in Or4c127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Or4c127 APN 2 89,833,365 (GRCm39) missense possibly damaging 0.65
IGL03303:Or4c127 APN 2 89,832,810 (GRCm39) missense possibly damaging 0.88
R1216:Or4c127 UTSW 2 89,832,822 (GRCm39) missense probably benign 0.23
R1256:Or4c127 UTSW 2 89,832,911 (GRCm39) missense possibly damaging 0.61
R1860:Or4c127 UTSW 2 89,833,490 (GRCm39) missense probably benign 0.26
R1864:Or4c127 UTSW 2 89,832,825 (GRCm39) missense probably benign 0.02
R1918:Or4c127 UTSW 2 89,832,918 (GRCm39) missense probably benign 0.12
R2192:Or4c127 UTSW 2 89,832,774 (GRCm39) missense probably damaging 0.99
R4155:Or4c127 UTSW 2 89,833,004 (GRCm39) missense probably benign 0.35
R4956:Or4c127 UTSW 2 89,833,187 (GRCm39) missense probably benign 0.33
R5298:Or4c127 UTSW 2 89,832,804 (GRCm39) missense possibly damaging 0.92
R5804:Or4c127 UTSW 2 89,833,332 (GRCm39) missense possibly damaging 0.91
R6766:Or4c127 UTSW 2 89,832,876 (GRCm39) missense probably benign 0.06
R7674:Or4c127 UTSW 2 89,833,389 (GRCm39) missense probably damaging 0.99
R8535:Or4c127 UTSW 2 89,833,511 (GRCm39) missense probably benign 0.19
Z1176:Or4c127 UTSW 2 89,833,392 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAGCGGGTCAATGTGTTTACTC -3'
(R):5'- CCTGTGCTAATTCTGGTACAAAATG -3'

Sequencing Primer
(F):5'- TTCGCTCCCTAAGGAATCACAGTG -3'
(R):5'- GGTATTCCTGCCTTGCTA -3'
Posted On 2015-02-05