Incidental Mutation 'R3024:Phf20'
ID265769
Institutional Source Beutler Lab
Gene Symbol Phf20
Ensembl Gene ENSMUSG00000038116
Gene NamePHD finger protein 20
Synonyms
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156196466-156309952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156287867 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 453 (H453R)
Ref Sequence ENSEMBL: ENSMUSP00000043138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037401]
Predicted Effect probably damaging
Transcript: ENSMUST00000037401
AA Change: H453R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043138
Gene: ENSMUSG00000038116
AA Change: H453R

DomainStartEndE-ValueType
TUDOR 11 71 5.27e0 SMART
TUDOR 85 141 7.13e-4 SMART
AT_hook 257 269 1.65e0 SMART
low complexity region 323 332 N/A INTRINSIC
ZnF_C2H2 455 480 1.86e0 SMART
low complexity region 486 493 N/A INTRINSIC
low complexity region 526 555 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
PHD 657 701 2.83e-4 SMART
coiled coil region 945 966 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152617
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased body size and total body fat amount, and abnormal skeletal and hematopoietic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Phf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Phf20 APN 2 156304816 critical splice donor site probably null
IGL01071:Phf20 APN 2 156294088 splice site probably null
IGL01125:Phf20 APN 2 156303184 splice site probably null
IGL01608:Phf20 APN 2 156276596 missense probably benign
IGL01610:Phf20 APN 2 156302889 nonsense probably null
IGL01845:Phf20 APN 2 156276657 nonsense probably null
IGL02364:Phf20 APN 2 156294097 missense possibly damaging 0.80
IGL02692:Phf20 APN 2 156298578 missense probably damaging 1.00
IGL03039:Phf20 APN 2 156298541 missense probably damaging 1.00
R0016:Phf20 UTSW 2 156267194 nonsense probably null
R0189:Phf20 UTSW 2 156303141 missense probably benign 0.02
R1532:Phf20 UTSW 2 156303049 missense possibly damaging 0.89
R1572:Phf20 UTSW 2 156287834 missense probably benign 0.17
R2007:Phf20 UTSW 2 156287954 missense probably benign 0.00
R2191:Phf20 UTSW 2 156276654 missense probably benign
R3011:Phf20 UTSW 2 156288026 missense probably benign 0.32
R4242:Phf20 UTSW 2 156307454 unclassified probably benign
R5053:Phf20 UTSW 2 156273862 missense probably benign 0.00
R5089:Phf20 UTSW 2 156302862 missense probably benign
R5382:Phf20 UTSW 2 156267497 missense probably damaging 1.00
R5649:Phf20 UTSW 2 156251768 splice site probably null
R5707:Phf20 UTSW 2 156296771 intron probably null
R5751:Phf20 UTSW 2 156267341 missense probably benign 0.01
R5805:Phf20 UTSW 2 156307294 missense probably damaging 0.99
R5988:Phf20 UTSW 2 156307330 missense probably damaging 1.00
R6179:Phf20 UTSW 2 156298653 missense probably damaging 1.00
R6243:Phf20 UTSW 2 156223400 missense probably benign 0.16
R6338:Phf20 UTSW 2 156273686 missense possibly damaging 0.93
R6351:Phf20 UTSW 2 156294210 missense possibly damaging 0.91
R6584:Phf20 UTSW 2 156294123 missense probably damaging 0.99
R7248:Phf20 UTSW 2 156293411 splice site probably null
R7329:Phf20 UTSW 2 156304632 missense probably damaging 0.96
R7387:Phf20 UTSW 2 156294240 missense probably damaging 1.00
R7528:Phf20 UTSW 2 156303008 nonsense probably null
R7603:Phf20 UTSW 2 156302851 missense probably benign
R7698:Phf20 UTSW 2 156294138 missense probably damaging 1.00
RF011:Phf20 UTSW 2 156304620 critical splice acceptor site probably benign
RF011:Phf20 UTSW 2 156304621 critical splice acceptor site probably benign
RF028:Phf20 UTSW 2 156304623 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTCCAAACAGTGCTTTGG -3'
(R):5'- TGGCTTGTCTTGTCAGGCAC -3'

Sequencing Primer
(F):5'- ATGTCTCAGGCAGTGTGAACC -3'
(R):5'- TCTTGTCAGGCACCGCAGAG -3'
Posted On2015-02-05