Mutagenetix > Incidental Mutation

Incidental Mutation 'R3024:Prex1'

265770

Institutional Source

Beutler Lab

Gene Symbol

Prex1

Ensembl Gene

ENSMUSG00000039621

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1

Synonyms

P-REX1

MMRRC Submission

040540-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R3024 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

166408265-166555752 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 166430956 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 615 (H615Q)

Ref Sequence

ENSEMBL: ENSMUSP00000096679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]

AlphaFold

Q69ZK0

Predicted Effect

probably benign
Transcript: ENSMUST00000036719
AA Change: H785Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: H785Q

Domain	Start	End	E-Value	Type
low complexity region	3	27	N/A	INTRINSIC
RhoGEF	48	234	3.16e-52	SMART
PH	267	389	1.02e-10	SMART
DEP	418	491	6.86e-27	SMART
DEP	519	592	3.06e-24	SMART
PDZ	628	701	4.55e-1	SMART
PDZ	712	783	5.66e-1	SMART
low complexity region	800	811	N/A	INTRINSIC
low complexity region	814	825	N/A	INTRINSIC
low complexity region	1109	1127	N/A	INTRINSIC
low complexity region	1545	1555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099080
AA Change: H615Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: H615Q

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	5	64	3.8e-18	PFAM
PH	97	219	1.02e-10	SMART
DEP	248	321	6.86e-27	SMART
DEP	349	422	3.06e-24	SMART
PDZ	458	531	4.55e-1	SMART
PDZ	542	613	5.66e-1	SMART
low complexity region	630	641	N/A	INTRINSIC
low complexity region	644	655	N/A	INTRINSIC
low complexity region	939	957	N/A	INTRINSIC
low complexity region	1375	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef37	T	C	18: 61,634,959 (GRCm39)	E461G	probably damaging	Het
Bfsp1	A	T	2: 143,687,879 (GRCm39)	V182D	probably benign	Het
Birc6	T	C	17: 74,915,214 (GRCm39)	S1635P	possibly damaging	Het
Chil6	T	C	3: 106,296,086 (GRCm39)	D383G	probably damaging	Het
Itpr2	G	A	6: 146,081,808 (GRCm39)	A175V	probably benign	Het
Kcnh7	G	T	2: 62,595,007 (GRCm39)	R688S	probably damaging	Het
Krt6a	A	T	15: 101,599,724 (GRCm39)	C463S	probably benign	Het
Ksr2	T	A	5: 117,693,125 (GRCm39)	I191N	possibly damaging	Het
Lyst	T	C	13: 13,833,272 (GRCm39)	V1698A	probably benign	Het
Or12d13	A	T	17: 37,647,918 (GRCm39)	D68E	probably damaging	Het
Or4c127	A	T	2: 89,833,584 (GRCm39)	N278I	probably damaging	Het
Pappa2	C	T	1: 158,763,795 (GRCm39)	R572Q	probably benign	Het
Pes1	CGGAGGAGGAGGAGGAGGAGGAGG	CGGAGGAGGAGGAGGAGGAGG	11: 3,927,719 (GRCm39)		probably benign	Het
Phf20	A	G	2: 156,129,787 (GRCm39)	H453R	probably damaging	Het
Slc25a54	T	A	3: 108,987,982 (GRCm39)	I41N	probably damaging	Het
Slc35f5	A	G	1: 125,496,335 (GRCm39)	S157G	probably benign	Het
Sstr3	G	A	15: 78,424,187 (GRCm39)	R187W	probably damaging	Het
Trim41	T	C	11: 48,698,985 (GRCm39)	K420E	possibly damaging	Het
Tsnaxip1	A	G	8: 106,568,375 (GRCm39)	Y353C	probably damaging	Het
Vmn1r238	T	C	18: 3,123,305 (GRCm39)	I36M	probably benign	Het
Xylt1	T	A	7: 117,147,883 (GRCm39)	V149D	probably damaging	Het
Zfpm2	G	A	15: 40,966,355 (GRCm39)	E815K	probably benign	Het

Other mutations in Prex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Prex1	APN	2	166,480,321 (GRCm39)	missense	probably damaging	1.00
IGL00309:Prex1	APN	2	166,451,743 (GRCm39)	missense	probably damaging	0.99
IGL00953:Prex1	APN	2	166,480,329 (GRCm39)	missense	probably damaging	1.00
IGL00961:Prex1	APN	2	166,427,656 (GRCm39)	missense	probably damaging	0.98
IGL01300:Prex1	APN	2	166,480,327 (GRCm39)	missense	possibly damaging	0.46
IGL01318:Prex1	APN	2	166,411,260 (GRCm39)	splice site	probably benign
IGL01753:Prex1	APN	2	166,444,802 (GRCm39)	missense	probably benign	0.11
IGL01819:Prex1	APN	2	166,463,165 (GRCm39)	missense	probably damaging	1.00
IGL02058:Prex1	APN	2	166,427,103 (GRCm39)	missense	probably benign	0.00
IGL02251:Prex1	APN	2	166,419,806 (GRCm39)	missense	probably damaging	0.99
IGL02326:Prex1	APN	2	166,463,105 (GRCm39)	missense	probably benign	0.35
IGL02366:Prex1	APN	2	166,422,347 (GRCm39)	missense	probably damaging	1.00
IGL02414:Prex1	APN	2	166,451,748 (GRCm39)	missense	probably damaging	1.00
IGL02660:Prex1	APN	2	166,435,787 (GRCm39)	missense	probably damaging	0.97
IGL02666:Prex1	APN	2	166,414,909 (GRCm39)	missense	probably benign	0.00
IGL02874:Prex1	APN	2	166,426,967 (GRCm39)	missense	probably damaging	1.00
IGL02935:Prex1	APN	2	166,412,265 (GRCm39)	missense	probably damaging	1.00
IGL03179:Prex1	APN	2	166,427,114 (GRCm39)	missense	probably benign	0.31
R0207:Prex1	UTSW	2	166,427,818 (GRCm39)	missense	possibly damaging	0.92
R0415:Prex1	UTSW	2	166,428,619 (GRCm39)	unclassified	probably benign
R0420:Prex1	UTSW	2	166,431,491 (GRCm39)	missense	probably benign	0.13
R0449:Prex1	UTSW	2	166,411,297 (GRCm39)	missense	probably benign	0.16
R0458:Prex1	UTSW	2	166,427,743 (GRCm39)	missense	probably damaging	0.99
R0927:Prex1	UTSW	2	166,428,457 (GRCm39)	missense	probably benign	0.01
R1299:Prex1	UTSW	2	166,427,827 (GRCm39)	missense	possibly damaging	0.62
R1414:Prex1	UTSW	2	166,435,781 (GRCm39)	missense	probably damaging	1.00
R1440:Prex1	UTSW	2	166,422,383 (GRCm39)	missense	probably damaging	0.98
R1506:Prex1	UTSW	2	166,429,001 (GRCm39)	missense	probably damaging	1.00
R1725:Prex1	UTSW	2	166,443,656 (GRCm39)	missense	probably damaging	1.00
R1831:Prex1	UTSW	2	166,427,021 (GRCm39)	missense	probably damaging	1.00
R1883:Prex1	UTSW	2	166,425,192 (GRCm39)	missense	probably benign	0.20
R1896:Prex1	UTSW	2	166,428,574 (GRCm39)	missense	probably benign	0.01
R2022:Prex1	UTSW	2	166,417,534 (GRCm39)	missense	possibly damaging	0.80
R2091:Prex1	UTSW	2	166,411,285 (GRCm39)	missense	possibly damaging	0.95
R2258:Prex1	UTSW	2	166,429,077 (GRCm39)	missense	probably benign	0.00
R2263:Prex1	UTSW	2	166,430,988 (GRCm39)	splice site	probably benign
R2276:Prex1	UTSW	2	166,419,875 (GRCm39)	missense	probably benign	0.34
R2279:Prex1	UTSW	2	166,419,875 (GRCm39)	missense	probably benign	0.34
R2680:Prex1	UTSW	2	166,443,692 (GRCm39)	missense	possibly damaging	0.92
R3421:Prex1	UTSW	2	166,459,774 (GRCm39)	missense	probably damaging	1.00
R3614:Prex1	UTSW	2	166,451,701 (GRCm39)	missense	probably damaging	1.00
R4244:Prex1	UTSW	2	166,412,256 (GRCm39)	missense	probably damaging	1.00
R4605:Prex1	UTSW	2	166,555,464 (GRCm39)	missense	probably benign	0.45
R4685:Prex1	UTSW	2	166,480,252 (GRCm39)	missense	probably damaging	0.97
R4787:Prex1	UTSW	2	166,480,260 (GRCm39)	missense	probably benign	0.01
R4796:Prex1	UTSW	2	166,434,211 (GRCm39)	missense	probably damaging	1.00
R4825:Prex1	UTSW	2	166,427,777 (GRCm39)	nonsense	probably null
R4955:Prex1	UTSW	2	166,415,143 (GRCm39)	missense	probably damaging	0.99
R5046:Prex1	UTSW	2	166,414,883 (GRCm39)	missense	probably benign	0.00
R5095:Prex1	UTSW	2	166,423,841 (GRCm39)	missense	probably damaging	1.00
R5408:Prex1	UTSW	2	166,417,573 (GRCm39)	small insertion	probably benign
R5462:Prex1	UTSW	2	166,486,728 (GRCm39)	missense	probably benign	0.02
R5535:Prex1	UTSW	2	166,422,193 (GRCm39)	missense	possibly damaging	0.80
R5777:Prex1	UTSW	2	166,428,579 (GRCm39)	missense	probably damaging	1.00
R5813:Prex1	UTSW	2	166,425,127 (GRCm39)	missense	probably benign
R5860:Prex1	UTSW	2	166,486,604 (GRCm39)	intron	probably benign
R5984:Prex1	UTSW	2	166,427,664 (GRCm39)	missense	probably damaging	1.00
R6009:Prex1	UTSW	2	166,423,904 (GRCm39)	missense	probably damaging	1.00
R6174:Prex1	UTSW	2	166,414,883 (GRCm39)	missense	probably benign	0.00
R6345:Prex1	UTSW	2	166,414,880 (GRCm39)	missense	probably null	0.81
R6897:Prex1	UTSW	2	166,423,913 (GRCm39)	missense	probably damaging	0.99
R6935:Prex1	UTSW	2	166,441,575 (GRCm39)	missense	probably damaging	1.00
R7025:Prex1	UTSW	2	166,455,107 (GRCm39)	small insertion	probably benign
R7037:Prex1	UTSW	2	166,429,100 (GRCm39)	missense	probably benign	0.05
R7076:Prex1	UTSW	2	166,475,302 (GRCm39)	missense	probably damaging	0.99
R7181:Prex1	UTSW	2	166,412,291 (GRCm39)	missense	probably damaging	1.00
R7361:Prex1	UTSW	2	166,555,490 (GRCm39)	missense	probably benign	0.04
R7381:Prex1	UTSW	2	166,429,047 (GRCm39)	missense	probably damaging	1.00
R7721:Prex1	UTSW	2	166,419,810 (GRCm39)	nonsense	probably null
R7763:Prex1	UTSW	2	166,555,629 (GRCm39)	missense	unknown
R7809:Prex1	UTSW	2	166,415,164 (GRCm39)	missense	possibly damaging	0.91
R7915:Prex1	UTSW	2	166,463,112 (GRCm39)	missense	probably damaging	1.00
R7971:Prex1	UTSW	2	166,423,859 (GRCm39)	missense	probably damaging	1.00
R7998:Prex1	UTSW	2	166,428,965 (GRCm39)	critical splice donor site	probably null
R8029:Prex1	UTSW	2	166,417,523 (GRCm39)	missense	probably benign	0.01
R8193:Prex1	UTSW	2	166,435,780 (GRCm39)	missense	possibly damaging	0.60
R8352:Prex1	UTSW	2	166,431,493 (GRCm39)	missense	probably benign	0.05
R8452:Prex1	UTSW	2	166,431,493 (GRCm39)	missense	probably benign	0.05
R8927:Prex1	UTSW	2	166,426,995 (GRCm39)	missense	probably damaging	0.97
R8928:Prex1	UTSW	2	166,426,995 (GRCm39)	missense	probably damaging	0.97
R9021:Prex1	UTSW	2	166,432,429 (GRCm39)	missense	possibly damaging	0.47
R9070:Prex1	UTSW	2	166,427,707 (GRCm39)	missense	probably damaging	1.00
R9213:Prex1	UTSW	2	166,417,669 (GRCm39)	missense	probably damaging	0.99
R9511:Prex1	UTSW	2	166,413,481 (GRCm39)	missense	probably damaging	1.00
R9514:Prex1	UTSW	2	166,419,896 (GRCm39)	missense	possibly damaging	0.53
R9529:Prex1	UTSW	2	166,431,518 (GRCm39)	missense	probably damaging	1.00
X0065:Prex1	UTSW	2	166,428,545 (GRCm39)	missense	probably benign
Z1176:Prex1	UTSW	2	166,414,890 (GRCm39)	nonsense	probably null
Z1177:Prex1	UTSW	2	166,434,148 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACTACAGTGTGAGCCGCTAAAG -3'
(R):5'- CCGCTTCAGAGTTGGTGTTC -3'

Sequencing Primer
(F):5'- TAAAGATGGGCCCTGCTCTGAG -3'
(R):5'- TGTTCCACCCCCAGCCAG -3'

Posted On

2015-02-05