Incidental Mutation 'R3024:Ksr2'
ID265773
Institutional Source Beutler Lab
Gene Symbol Ksr2
Ensembl Gene ENSMUSG00000061578
Gene Namekinase suppressor of ras 2
Synonyms
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117414000-117775003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117555060 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 191 (I191N)
Ref Sequence ENSEMBL: ENSMUSP00000137670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180430]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000073347
Predicted Effect possibly damaging
Transcript: ENSMUST00000180430
AA Change: I191N

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137670
Gene: ENSMUSG00000061578
AA Change: I191N

DomainStartEndE-ValueType
Pfam:KSR1-SAM 24 152 1.1e-45 PFAM
low complexity region 258 282 N/A INTRINSIC
low complexity region 326 341 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
C1 412 457 2.74e-8 SMART
low complexity region 518 551 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
Pfam:Pkinase 667 929 1.1e-41 PFAM
Pfam:Pkinase_Tyr 667 929 1.8e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit increased body fat and obesity, resulting from hyperphagia. Mice are also glucose intolerant and have high serum cholesterol, ALT, serum lipids and show hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Ksr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Ksr2 APN 5 117616894 missense possibly damaging 0.52
IGL02231:Ksr2 APN 5 117500776 missense probably damaging 1.00
IGL02634:Ksr2 APN 5 117763329 splice site probably benign
IGL02669:Ksr2 APN 5 117555381 missense probably damaging 1.00
IGL03116:Ksr2 APN 5 117707957 missense probably benign 0.20
IGL03168:Ksr2 APN 5 117748781 missense probably damaging 1.00
IGL03372:Ksr2 APN 5 117702718 missense possibly damaging 0.93
gigante UTSW 5 117671449 missense probably damaging 0.99
R0133:Ksr2 UTSW 5 117555294 missense possibly damaging 0.95
R0811:Ksr2 UTSW 5 117555225 missense probably damaging 1.00
R0812:Ksr2 UTSW 5 117555225 missense probably damaging 1.00
R1162:Ksr2 UTSW 5 117554955 splice site probably benign
R1420:Ksr2 UTSW 5 117414839 missense probably benign 0.10
R1717:Ksr2 UTSW 5 117671449 missense probably damaging 0.99
R1809:Ksr2 UTSW 5 117555470 missense probably damaging 1.00
R1859:Ksr2 UTSW 5 117414941 missense probably damaging 1.00
R1867:Ksr2 UTSW 5 117505529 missense probably benign 0.32
R1868:Ksr2 UTSW 5 117505529 missense probably benign 0.32
R3499:Ksr2 UTSW 5 117689575 missense probably damaging 1.00
R3687:Ksr2 UTSW 5 117554979 missense probably damaging 0.98
R3688:Ksr2 UTSW 5 117554979 missense probably damaging 0.98
R4044:Ksr2 UTSW 5 117555062 nonsense probably null
R4579:Ksr2 UTSW 5 117756270 missense probably damaging 0.99
R4697:Ksr2 UTSW 5 117708147 missense probably damaging 1.00
R4834:Ksr2 UTSW 5 117668327 missense probably benign 0.37
R5016:Ksr2 UTSW 5 117500792 missense probably benign 0.10
R5107:Ksr2 UTSW 5 117689608 missense probably benign 0.01
R5150:Ksr2 UTSW 5 117555009 missense probably damaging 0.97
R5326:Ksr2 UTSW 5 117708240 missense probably damaging 1.00
R5493:Ksr2 UTSW 5 117708110 missense probably damaging 1.00
R5738:Ksr2 UTSW 5 117748799 missense probably damaging 0.97
R6257:Ksr2 UTSW 5 117414844 missense probably benign 0.01
R6316:Ksr2 UTSW 5 117685502 missense probably damaging 1.00
R6389:Ksr2 UTSW 5 117414842 missense probably benign 0.09
R6460:Ksr2 UTSW 5 117756384 critical splice donor site probably null
R6874:Ksr2 UTSW 5 117756336 nonsense probably null
R6939:Ksr2 UTSW 5 117765561 makesense probably null
R7352:Ksr2 UTSW 5 117689641 missense probably benign 0.00
R7594:Ksr2 UTSW 5 117555066 missense possibly damaging 0.89
R7840:Ksr2 UTSW 5 117555264 missense probably benign 0.00
R7923:Ksr2 UTSW 5 117555264 missense probably benign 0.00
R8152:Ksr2 UTSW 5 117671458 missense probably damaging 1.00
RF020:Ksr2 UTSW 5 117555218 missense probably benign
Z1088:Ksr2 UTSW 5 117747402 missense probably damaging 1.00
Z1177:Ksr2 UTSW 5 117708200 missense probably damaging 1.00
Z1177:Ksr2 UTSW 5 117747408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGATGGTGGATCTTTGCCTAC -3'
(R):5'- ACAATATTTGGGGTGCGAGG -3'

Sequencing Primer
(F):5'- TACAGCGACCCTACCCCTTC -3'
(R):5'- AGGTGGGGTGCGGACTAC -3'
Posted On2015-02-05