Incidental Mutation 'R3024:Xylt1'
List |< first << previous [record 22 of 23] next >> last >|
ID265775
Institutional Source Beutler Lab
Gene Symbol Xylt1
Ensembl Gene ENSMUSG00000030657
Gene Namexylosyltransferase 1
Synonyms
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location117380979-117673580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117548648 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 149 (V149D)
Ref Sequence ENSEMBL: ENSMUSP00000032892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032892]
Predicted Effect probably damaging
Transcript: ENSMUST00000032892
AA Change: V149D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032892
Gene: ENSMUSG00000030657
AA Change: V149D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 75 104 N/A INTRINSIC
Pfam:Branch 322 577 7.8e-53 PFAM
Pfam:Xylo_C 607 787 2.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161889
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial preweaning lethality, impaired chondrocyte maturation and decreased skeletal length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Xylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Xylt1 APN 7 117650685 missense probably damaging 0.99
IGL01306:Xylt1 APN 7 117548890 missense probably benign 0.00
IGL01656:Xylt1 APN 7 117548993 missense probably damaging 1.00
IGL02152:Xylt1 APN 7 117634770 missense probably damaging 1.00
IGL02188:Xylt1 APN 7 117634737 missense probably damaging 1.00
IGL02732:Xylt1 APN 7 117591937 missense possibly damaging 0.75
IGL02944:Xylt1 APN 7 117634757 missense probably benign 0.00
IGL03308:Xylt1 APN 7 117637751 nonsense probably null
IGL03393:Xylt1 APN 7 117593713 missense probably damaging 1.00
phloem UTSW 7 117656584 missense probably damaging 1.00
xylem UTSW 7 117592036 missense probably damaging 1.00
ANU23:Xylt1 UTSW 7 117548890 missense probably benign 0.00
PIT4378001:Xylt1 UTSW 7 117548865 missense possibly damaging 0.83
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0970:Xylt1 UTSW 7 117634736 missense probably damaging 0.96
R1433:Xylt1 UTSW 7 117591952 missense possibly damaging 0.51
R1762:Xylt1 UTSW 7 117637761 missense probably benign 0.00
R2169:Xylt1 UTSW 7 117667437 missense probably damaging 1.00
R2937:Xylt1 UTSW 7 117634784 missense probably benign 0.04
R3855:Xylt1 UTSW 7 117593550 missense probably damaging 1.00
R4006:Xylt1 UTSW 7 117475513 missense probably benign 0.01
R4329:Xylt1 UTSW 7 117656461 missense probably damaging 1.00
R4794:Xylt1 UTSW 7 117637635 missense probably benign 0.07
R4975:Xylt1 UTSW 7 117667342 missense probably damaging 1.00
R5225:Xylt1 UTSW 7 117592036 missense probably damaging 1.00
R5679:Xylt1 UTSW 7 117643650 missense probably damaging 1.00
R5707:Xylt1 UTSW 7 117656494 missense possibly damaging 0.95
R5756:Xylt1 UTSW 7 117650700 missense probably damaging 0.97
R5802:Xylt1 UTSW 7 117656691 missense probably benign 0.43
R6057:Xylt1 UTSW 7 117591908 missense probably benign 0.02
R6249:Xylt1 UTSW 7 117667305 missense probably benign 0.11
R6298:Xylt1 UTSW 7 117656737 missense probably damaging 0.96
R7159:Xylt1 UTSW 7 117637602 missense probably damaging 1.00
R7198:Xylt1 UTSW 7 117656584 missense probably damaging 1.00
R7323:Xylt1 UTSW 7 117592047 critical splice donor site probably null
R7449:Xylt1 UTSW 7 117592005 missense possibly damaging 0.55
R7545:Xylt1 UTSW 7 117593585 missense probably benign 0.11
R7786:Xylt1 UTSW 7 117643475 splice site probably null
R7849:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7867:Xylt1 UTSW 7 117475514 missense probably benign 0.12
R7932:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7950:Xylt1 UTSW 7 117475514 missense probably benign 0.12
R8169:Xylt1 UTSW 7 117650619 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTCCGAGCCAATGAGAG -3'
(R):5'- GAGATCCTTCCCTTGGCTACTG -3'

Sequencing Primer
(F):5'- TGAGAGAGAAGAATGGCAGTCTTG -3'
(R):5'- CTGTGGCTTTCTCCCGAGG -3'
Posted On2015-02-05